Incidental Mutation 'R6036:Ehmt2'
ID486604
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Nameeuchromatic histone lysine N-methyltransferase 2
SynonymsNG36, D17Ertd710e, G9a, KMT1C, Bat8
MMRRC Submission 043257-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6036 (G1)
Quality Score117.008
Status Not validated
Chromosome17
Chromosomal Location34898469-34914052 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34899091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 40 (R40*)
Ref Sequence ENSEMBL: ENSMUSP00000094955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013931] [ENSMUST00000052778] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000148431] [ENSMUST00000173093]
Predicted Effect probably null
Transcript: ENSMUST00000013931
AA Change: R40*
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787
AA Change: R40*

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052778
SMART Domains Protein: ENSMUSP00000057515
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
BTB 33 127 1.5e-19 SMART
low complexity region 138 149 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 186 204 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 297 327 N/A INTRINSIC
ZnF_C2H2 333 356 4.4e-2 SMART
ZnF_C2H2 359 381 2.27e-4 SMART
ZnF_C2H2 387 409 1.25e-1 SMART
ZnF_C2H2 415 438 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078061
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097342
AA Change: R40*
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787
AA Change: R40*

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146418
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173093
SMART Domains Protein: ENSMUSP00000133903
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
Pfam:BTB 23 68 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174880
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 T C 11: 95,832,858 probably benign Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Alpk3 G A 7: 81,093,257 V941M probably benign Het
Ano4 A G 10: 88,982,265 W588R possibly damaging Het
Atp6v1a A G 16: 44,098,831 Y464H probably benign Het
Barx2 A T 9: 31,913,008 D28E probably damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Col10a1 A G 10: 34,395,282 T417A probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Eif4enif1 T C 11: 3,239,420 S227P probably damaging Het
Erv3 G A 2: 131,856,005 H145Y possibly damaging Het
Exoc5 T C 14: 49,014,322 T591A possibly damaging Het
F5 A T 1: 164,184,996 E493V probably damaging Het
Gm8444 G T 15: 81,843,593 probably benign Het
Gria4 T A 9: 4,537,646 I221L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hc T C 2: 35,039,684 T249A probably benign Het
Herc2 A G 7: 56,068,053 T48A probably benign Het
Hist1h2bl A T 13: 21,715,978 S56T probably damaging Het
Hp A G 8: 109,576,774 probably null Het
Ifna15 T G 4: 88,558,073 D58A possibly damaging Het
Kcnj1 A T 9: 32,397,125 M262L probably benign Het
Krt83 A C 15: 101,487,531 I320S possibly damaging Het
Megf10 A G 18: 57,242,727 N242D probably damaging Het
Nup155 A G 15: 8,128,411 T451A probably benign Het
Olfr1277 C T 2: 111,269,612 G252R probably damaging Het
Olfr1288 T C 2: 111,478,988 L68P probably damaging Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr701 A T 7: 106,818,460 I126F probably damaging Het
Olfr930 A G 9: 38,930,920 I250V probably damaging Het
Pdzd8 G A 19: 59,305,209 P403S probably damaging Het
Piezo2 G A 18: 63,114,948 Q494* probably null Het
Pik3c2b T C 1: 133,090,713 F966S possibly damaging Het
Plag1 T C 4: 3,904,618 E191G possibly damaging Het
Pou4f2 A T 8: 78,435,474 S167T probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scd4 G A 19: 44,344,792 D319N probably damaging Het
Senp2 A T 16: 22,028,558 R279* probably null Het
Sh3rf3 G A 10: 58,813,984 G137D probably benign Het
Simc1 C T 13: 54,524,621 P261S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc26a1 T A 5: 108,673,570 D151V probably damaging Het
Snx29 A G 16: 11,738,437 probably null Het
Stard9 C T 2: 120,700,075 A2271V probably benign Het
Stat6 A G 10: 127,655,444 N485D possibly damaging Het
Tpcn2 T C 7: 145,268,869 T280A possibly damaging Het
Ttc23 A G 7: 67,711,366 I378V possibly damaging Het
Ttc29 A G 8: 78,325,576 D362G probably benign Het
Ttll7 A G 3: 146,940,162 I592V probably benign Het
Ugt3a1 A T 15: 9,306,086 H107L probably benign Het
Vmn1r70 A G 7: 10,633,903 Q87R probably damaging Het
Vmn2r-ps129 T C 17: 22,995,172 noncoding transcript Het
Wdfy4 G T 14: 33,146,990 S360R probably damaging Het
Zfp780b A G 7: 27,963,568 Y521H probably damaging Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 34910815 missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 34908479 missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 34910767 missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 34910822 missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 34906811 missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 34899842 missense probably benign 0.02
R0778:Ehmt2 UTSW 17 34905418 missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 34906504 missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1693:Ehmt2 UTSW 17 34906410 missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 34910776 missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 34899365 missense probably benign
R2275:Ehmt2 UTSW 17 34910715 missense possibly damaging 0.95
R3761:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 34906765 missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 34903467 missense probably damaging 0.99
R4303:Ehmt2 UTSW 17 34908748 missense possibly damaging 0.92
R4529:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 34913814 missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 34906964 missense probably benign
R5061:Ehmt2 UTSW 17 34899091 nonsense probably null
R5158:Ehmt2 UTSW 17 34911664 missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 34899091 nonsense probably null
R5299:Ehmt2 UTSW 17 34899091 nonsense probably null
R5523:Ehmt2 UTSW 17 34899091 nonsense probably null
R5524:Ehmt2 UTSW 17 34899091 nonsense probably null
R5727:Ehmt2 UTSW 17 34906032 missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 34908238 missense probably benign 0.05
R5786:Ehmt2 UTSW 17 34910743 missense probably damaging 1.00
R5951:Ehmt2 UTSW 17 34899381 missense probably benign
R6162:Ehmt2 UTSW 17 34899091 nonsense probably null
R6708:Ehmt2 UTSW 17 34899899 nonsense probably null
R6889:Ehmt2 UTSW 17 34912772 missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 34911430 missense probably damaging 1.00
R7470:Ehmt2 UTSW 17 34899396 missense possibly damaging 0.67
R8061:Ehmt2 UTSW 17 34905927 missense possibly damaging 0.66
R8095:Ehmt2 UTSW 17 34907769 missense probably damaging 1.00
R8169:Ehmt2 UTSW 17 34903363 missense probably benign
R8175:Ehmt2 UTSW 17 34911420 missense probably damaging 1.00
R8244:Ehmt2 UTSW 17 34905262 missense probably damaging 1.00
R8357:Ehmt2 UTSW 17 34905161 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTTACAGCAAACCAGGGG -3'
(R):5'- AGCTATGAACTGTCGGGAGG -3'

Sequencing Primer
(F):5'- GCAAACCAGGGGGCCAAC -3'
(R):5'- TGAAAGCTCCCGGGATCC -3'
Posted On2017-08-16