Mutagenetix > Incidental Mutations

Incidental Mutation 'R6037:Cacna1s'

486610

Institutional Source

Beutler Lab

Gene Symbol

Cacna1s

Ensembl Gene

ENSMUSG00000026407

Gene Name

calcium channel, voltage-dependent, L type, alpha 1S subunit

Synonyms

sj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd

MMRRC Submission

043258-MU

Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

136052750-136119822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136070967 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 200 (A200V)

Ref Sequence

ENSEMBL: ENSMUSP00000125278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112064
AA Change: A200V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: A200V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	50	345	4.3e-68	PFAM
Pfam:Ion_trans	431	672	4.5e-56	PFAM
Pfam:PKD_channel	516	667	1.9e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
Pfam:Ion_trans	798	1076	2.6e-65	PFAM
Pfam:Ion_trans	1117	1392	1.2e-71	PFAM
Pfam:PKD_channel	1126	1387	8.4e-13	PFAM
Pfam:GPHH	1394	1463	2.3e-38	PFAM
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC
Pfam:CAC1F_C	1756	1845	2.8e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112068
AA Change: A200V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: A200V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.1e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.7e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	3.9e-53	PFAM
Pfam:Ion_trans	1152	1361	6.7e-66	PFAM
Pfam:PKD_channel	1201	1368	8.4e-10	PFAM
Blast:EFh	1382	1410	5e-8	BLAST
Ca_chan_IQ	1496	1529	3.71e-14	SMART
low complexity region	1638	1650	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160641
AA Change: A200V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: A200V

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.3e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.8e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	4e-53	PFAM
Pfam:PKD_channel	1126	1387	6.1e-12	PFAM
Pfam:Ion_trans	1152	1380	9e-65	PFAM
Blast:EFh	1401	1429	5e-8	BLAST
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161865

SMART Domains

Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	3	98	1.1e-21	PFAM
Pfam:Ion_trans	184	425	3.3e-56	PFAM
Pfam:PKD_channel	267	420	1.8e-7	PFAM
low complexity region	428	438	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
Pfam:Ion_trans	551	829	1.9e-65	PFAM
Pfam:Ion_trans	870	1126	5.4e-72	PFAM
Pfam:PKD_channel	954	1121	7.2e-10	PFAM
Pfam:GPHH	1128	1197	1.8e-38	PFAM
Ca_chan_IQ	1249	1282	3.71e-14	SMART
low complexity region	1391	1403	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abi2	C	A	1: 60,464,579	P212T	probably damaging	Het
Ano4	A	G	10: 89,317,246	F68S	possibly damaging	Het
Art5	C	A	7: 102,098,384	A63S	probably benign	Het
Asgr1	T	A	11: 70,056,421	S96R	probably benign	Het
Bdp1	A	T	13: 100,027,449	V2248D	possibly damaging	Het
Cacna2d2	A	G	9: 107,513,539	K357E	probably damaging	Het
Cfap52	C	T	11: 67,946,300	G212R	probably benign	Het
Dcun1d3	A	G	7: 119,857,742	F249S	probably damaging	Het
Ece2	A	G	16: 20,630,362	Y17C	probably damaging	Het
Efemp1	C	T	11: 28,921,760	T425I	probably damaging	Het
Eprs	A	G	1: 185,396,109	E562G	probably damaging	Het
Fbn2	T	C	18: 58,044,223	T2001A	probably benign	Het
Flt4	G	A	11: 49,637,040	R940H	probably damaging	Het
Fry	T	A	5: 150,428,179	M1716K	probably benign	Het
Gm10684	T	A	9: 45,107,741		probably benign	Het
Gm281	T	C	14: 13,864,282	N348S	probably damaging	Het
Hivep1	G	A	13: 42,157,940	V1219I	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Il23r	C	T	6: 67,478,954	V177M	probably damaging	Het
Klf12	T	C	14: 99,900,214	S299G	probably benign	Het
Lama5	G	A	2: 180,207,013	R265C	probably damaging	Het
Lifr	A	G	15: 7,186,943	T800A	probably damaging	Het
Megf8	T	C	7: 25,364,406	L2729P	probably damaging	Het
Mki67	A	C	7: 135,696,803	S2167R	possibly damaging	Het
Mus81	T	C	19: 5,484,004	K400E	probably damaging	Het
Nomo1	T	A	7: 46,062,999	I656N	possibly damaging	Het
Oas3	T	C	5: 120,769,319	T418A	probably benign	Het
Olfr1034	T	C	2: 86,046,584	M34T	probably benign	Het
Olfr1066	T	A	2: 86,455,789	I161L	probably benign	Het
Olfr147	T	A	9: 38,403,305	C144S	probably benign	Het
Olfr301	C	T	7: 86,413,270	L303F	probably benign	Het
Olfr936	A	G	9: 39,047,107	V104A	probably damaging	Het
Olr1	A	G	6: 129,493,541	L221P	probably damaging	Het
Pih1d1	C	T	7: 45,156,314	A69V	probably damaging	Het
Pkdrej	A	C	15: 85,819,766	S656R	probably damaging	Het
Polr3f	A	G	2: 144,536,023	D171G	probably damaging	Het
Rasal1	T	C	5: 120,649,501	V11A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Sptbn4	T	A	7: 27,364,170	Y2277F	probably damaging	Het
St6galnac6	A	G	2: 32,612,228	Q7R	probably damaging	Het
Thrsp	T	G	7: 97,417,292	D71A	possibly damaging	Het
Vmn2r1	C	A	3: 64,081,729	Q30K	probably benign	Het
Wipf2	C	T	11: 98,896,179	P345S	probably benign	Het
Zeb2	G	T	2: 44,988,640	S1170*	probably null	Het
Zfp947	A	G	17: 22,147,434	Y38H	probably damaging	Het

Other mutations in Cacna1s

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Cacna1s	APN	1	136084273	nonsense	probably null
IGL00517:Cacna1s	APN	1	136087339	missense	probably damaging	1.00
IGL01316:Cacna1s	APN	1	136118964	missense	probably benign	0.01
IGL01348:Cacna1s	APN	1	136075152	missense	possibly damaging	0.95
IGL01739:Cacna1s	APN	1	136097132	critical splice donor site	probably null
IGL01773:Cacna1s	APN	1	136118753	missense	probably benign	0.32
IGL02056:Cacna1s	APN	1	136119000	missense	probably benign
IGL02262:Cacna1s	APN	1	136108129	missense	probably damaging	0.98
IGL02324:Cacna1s	APN	1	136075176	splice site	probably benign
IGL02352:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02359:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02370:Cacna1s	APN	1	136085347	missense	probably damaging	1.00
IGL02377:Cacna1s	APN	1	136068994	missense	probably damaging	1.00
IGL02474:Cacna1s	APN	1	136118380	missense	probably benign
IGL02606:Cacna1s	APN	1	136079519	missense	probably damaging	0.99
IGL02833:Cacna1s	APN	1	136071005	missense	probably benign	0.03
IGL02974:Cacna1s	APN	1	136092617	missense	possibly damaging	0.78
IGL03064:Cacna1s	APN	1	136111993	missense	probably damaging	1.00
IGL03093:Cacna1s	APN	1	136116064	missense	probably benign	0.00
IGL03286:Cacna1s	APN	1	136077659	missense	probably benign
N/A:Cacna1s	UTSW	1	136073509	missense	probably benign	0.00
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0240:Cacna1s	UTSW	1	136073496	unclassified	probably benign
R0255:Cacna1s	UTSW	1	136118806	missense	possibly damaging	0.93
R0302:Cacna1s	UTSW	1	136100604	missense	probably benign	0.01
R0319:Cacna1s	UTSW	1	136070717	missense	probably damaging	0.99
R0411:Cacna1s	UTSW	1	136113303	missense	probably damaging	1.00
R0413:Cacna1s	UTSW	1	136098209	missense	probably benign	0.00
R0482:Cacna1s	UTSW	1	136113394	missense	probably benign
R0491:Cacna1s	UTSW	1	136089008	splice site	probably benign
R0518:Cacna1s	UTSW	1	136076859	missense	probably benign
R0717:Cacna1s	UTSW	1	136098291	missense	probably damaging	1.00
R0725:Cacna1s	UTSW	1	136098526	splice site	probably benign
R0815:Cacna1s	UTSW	1	136112957	missense	possibly damaging	0.95
R1384:Cacna1s	UTSW	1	136094971	missense	probably benign	0.02
R1518:Cacna1s	UTSW	1	136098551	missense	probably damaging	1.00
R1548:Cacna1s	UTSW	1	136110937	missense	probably damaging	1.00
R1725:Cacna1s	UTSW	1	136098623	missense	probably damaging	1.00
R1728:Cacna1s	UTSW	1	136118716	missense	probably benign
R1729:Cacna1s	UTSW	1	136118716	missense	probably benign
R1730:Cacna1s	UTSW	1	136118716	missense	probably benign
R1739:Cacna1s	UTSW	1	136118716	missense	probably benign
R1762:Cacna1s	UTSW	1	136118716	missense	probably benign
R1783:Cacna1s	UTSW	1	136118716	missense	probably benign
R1784:Cacna1s	UTSW	1	136118716	missense	probably benign
R1785:Cacna1s	UTSW	1	136118716	missense	probably benign
R1800:Cacna1s	UTSW	1	136076854	missense	probably benign
R1924:Cacna1s	UTSW	1	136089017	splice site	probably null
R1969:Cacna1s	UTSW	1	136119095	missense	probably benign	0.42
R2072:Cacna1s	UTSW	1	136079504	missense	probably benign
R2380:Cacna1s	UTSW	1	136095848	missense	probably damaging	1.00
R3110:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3112:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3151:Cacna1s	UTSW	1	136105794	missense	probably damaging	1.00
R3696:Cacna1s	UTSW	1	136105814	missense	probably damaging	1.00
R3722:Cacna1s	UTSW	1	136069042	missense	possibly damaging	0.77
R3804:Cacna1s	UTSW	1	136107018	missense	possibly damaging	0.85
R3813:Cacna1s	UTSW	1	136085347	missense	probably damaging	1.00
R3905:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3907:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3909:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R4170:Cacna1s	UTSW	1	136108195	missense	probably damaging	1.00
R4329:Cacna1s	UTSW	1	136119033	missense	probably benign	0.00
R4485:Cacna1s	UTSW	1	136076852	missense	probably damaging	1.00
R4581:Cacna1s	UTSW	1	136070970	unclassified	probably null
R4719:Cacna1s	UTSW	1	136118652	splice site	probably benign
R4816:Cacna1s	UTSW	1	136115269	missense	possibly damaging	0.89
R4909:Cacna1s	UTSW	1	136079604	missense	probably damaging	0.99
R4917:Cacna1s	UTSW	1	136101564	critical splice donor site	probably null
R5296:Cacna1s	UTSW	1	136095785	missense	probably benign	0.11
R5411:Cacna1s	UTSW	1	136105811	missense	probably benign	0.09
R5503:Cacna1s	UTSW	1	136086742	missense	probably damaging	1.00
R5533:Cacna1s	UTSW	1	136098375	critical splice donor site	probably null
R5714:Cacna1s	UTSW	1	136112066	missense	probably benign	0.44
R5775:Cacna1s	UTSW	1	136108122	missense	probably damaging	1.00
R5814:Cacna1s	UTSW	1	136107142	missense	probably benign	0.31
R5820:Cacna1s	UTSW	1	136079604	missense	probably damaging	1.00
R5822:Cacna1s	UTSW	1	136112078	missense	probably damaging	1.00
R5877:Cacna1s	UTSW	1	136100667	missense	probably damaging	0.99
R5923:Cacna1s	UTSW	1	136076822	missense	possibly damaging	0.79
R6021:Cacna1s	UTSW	1	136106487	missense	probably benign	0.15
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6056:Cacna1s	UTSW	1	136105836	missense	probably damaging	1.00
R6143:Cacna1s	UTSW	1	136076758	missense	probably damaging	0.99
R6222:Cacna1s	UTSW	1	136104622	missense	probably benign	0.00
R6237:Cacna1s	UTSW	1	136105844	missense	possibly damaging	0.88
R6274:Cacna1s	UTSW	1	136089045	missense	probably benign	0.02
R6609:Cacna1s	UTSW	1	136113391	missense	probably benign	0.30
R6626:Cacna1s	UTSW	1	136094965	missense	probably damaging	1.00
R6838:Cacna1s	UTSW	1	136084437	missense	possibly damaging	0.91
R6848:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6849:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6850:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6851:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6868:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6879:Cacna1s	UTSW	1	136115959	missense	probably benign	0.12
R6893:Cacna1s	UTSW	1	136077693	missense	probably benign	0.05
R7017:Cacna1s	UTSW	1	136095858	missense	probably damaging	0.99
R7228:Cacna1s	UTSW	1	136071059	missense	possibly damaging	0.90
R7283:Cacna1s	UTSW	1	136073708	missense	probably damaging	1.00
R7357:Cacna1s	UTSW	1	136071021	missense	probably damaging	0.99
R7385:Cacna1s	UTSW	1	136092633	missense	probably damaging	0.99
R7421:Cacna1s	UTSW	1	136086802	missense	probably damaging	1.00
R7505:Cacna1s	UTSW	1	136085449	nonsense	probably null
R7519:Cacna1s	UTSW	1	136070756	missense	probably damaging	0.99
R7675:Cacna1s	UTSW	1	136110874	missense	probably damaging	1.00
R7746:Cacna1s	UTSW	1	136069018	missense	probably damaging	0.99
R7779:Cacna1s	UTSW	1	136119029	missense	probably damaging	1.00
R7850:Cacna1s	UTSW	1	136071048	missense	probably damaging	1.00
R7933:Cacna1s	UTSW	1	136071048	missense	probably damaging	1.00
X0025:Cacna1s	UTSW	1	136115970	missense	probably benign	0.00
Z1176:Cacna1s	UTSW	1	136107084	nonsense	probably null
Z1177:Cacna1s	UTSW	1	136117686	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACAGTGTCTCTTCTCCCAAGC -3'
(R):5'- GCTCCAAGGTGCATTAGTGGAG -3'

Sequencing Primer
(F):5'- AAGCCCTCCTTTGCCCC -3'
(R):5'- GGCTTTGACCCCGAGCTTC -3'

Posted On

2017-08-16