Mutagenetix > Incidental Mutations

Incidental Mutation 'R6037:Eprs'

486611

Institutional Source

Beutler Lab

Gene Symbol

Eprs

Ensembl Gene

ENSMUSG00000026615

Gene Name

glutamyl-prolyl-tRNA synthetase

Synonyms

2410081F06Rik, 3010002K18Rik, Qprs

MMRRC Submission

043258-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

185363044-185428360 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 185396109 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 562 (E562G)

Ref Sequence

ENSEMBL: ENSMUSP00000045841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046514]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046514
AA Change: E562G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: E562G

Domain	Start	End	E-Value	Type
Pfam:GST_C_3	71	156	2.1e-15	PFAM
Pfam:GST_C	72	157	2.9e-7	PFAM
Pfam:tRNA-synt_1c	197	502	8.8e-127	PFAM
Pfam:tRNA-synt_1c_C	504	681	4.4e-42	PFAM
WHEP-TRS	753	815	1.26e-25	SMART
WHEP-TRS	826	888	1.47e-26	SMART
WHEP-TRS	904	966	3.76e-24	SMART
low complexity region	984	1011	N/A	INTRINSIC
Pfam:tRNA-synt_2b	1107	1287	3.1e-17	PFAM
Pfam:HGTP_anticodon	1303	1404	1.7e-19	PFAM
ProRS-C_1	1430	1512	5.27e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192284

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abi2	C	A	1: 60,464,579	P212T	probably damaging	Het
Ano4	A	G	10: 89,317,246	F68S	possibly damaging	Het
Art5	C	A	7: 102,098,384	A63S	probably benign	Het
Asgr1	T	A	11: 70,056,421	S96R	probably benign	Het
Bdp1	A	T	13: 100,027,449	V2248D	possibly damaging	Het
Cacna1s	C	T	1: 136,070,967	A200V	possibly damaging	Het
Cacna2d2	A	G	9: 107,513,539	K357E	probably damaging	Het
Cfap52	C	T	11: 67,946,300	G212R	probably benign	Het
Dcun1d3	A	G	7: 119,857,742	F249S	probably damaging	Het
Ece2	A	G	16: 20,630,362	Y17C	probably damaging	Het
Efemp1	C	T	11: 28,921,760	T425I	probably damaging	Het
Fbn2	T	C	18: 58,044,223	T2001A	probably benign	Het
Flt4	G	A	11: 49,637,040	R940H	probably damaging	Het
Fry	T	A	5: 150,428,179	M1716K	probably benign	Het
Gm10684	T	A	9: 45,107,741		probably benign	Het
Gm281	T	C	14: 13,864,282	N348S	probably damaging	Het
Hivep1	G	A	13: 42,157,940	V1219I	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Il23r	C	T	6: 67,478,954	V177M	probably damaging	Het
Klf12	T	C	14: 99,900,214	S299G	probably benign	Het
Lama5	G	A	2: 180,207,013	R265C	probably damaging	Het
Lifr	A	G	15: 7,186,943	T800A	probably damaging	Het
Megf8	T	C	7: 25,364,406	L2729P	probably damaging	Het
Mki67	A	C	7: 135,696,803	S2167R	possibly damaging	Het
Mus81	T	C	19: 5,484,004	K400E	probably damaging	Het
Nomo1	T	A	7: 46,062,999	I656N	possibly damaging	Het
Oas3	T	C	5: 120,769,319	T418A	probably benign	Het
Olfr1034	T	C	2: 86,046,584	M34T	probably benign	Het
Olfr1066	T	A	2: 86,455,789	I161L	probably benign	Het
Olfr147	T	A	9: 38,403,305	C144S	probably benign	Het
Olfr301	C	T	7: 86,413,270	L303F	probably benign	Het
Olfr936	A	G	9: 39,047,107	V104A	probably damaging	Het
Olr1	A	G	6: 129,493,541	L221P	probably damaging	Het
Pih1d1	C	T	7: 45,156,314	A69V	probably damaging	Het
Pkdrej	A	C	15: 85,819,766	S656R	probably damaging	Het
Polr3f	A	G	2: 144,536,023	D171G	probably damaging	Het
Rasal1	T	C	5: 120,649,501	V11A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Sptbn4	T	A	7: 27,364,170	Y2277F	probably damaging	Het
St6galnac6	A	G	2: 32,612,228	Q7R	probably damaging	Het
Thrsp	T	G	7: 97,417,292	D71A	possibly damaging	Het
Vmn2r1	C	A	3: 64,081,729	Q30K	probably benign	Het
Wipf2	C	T	11: 98,896,179	P345S	probably benign	Het
Zeb2	G	T	2: 44,988,640	S1170*	probably null	Het
Zfp947	A	G	17: 22,147,434	Y38H	probably damaging	Het

Other mutations in Eprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00532:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00543:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00553:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00574:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00583:Eprs	APN	1	185407148	missense	probably benign	0.11
IGL00946:Eprs	APN	1	185407701	missense	probably benign	0.02
IGL01062:Eprs	APN	1	185379615	missense	probably benign	0.19
IGL01477:Eprs	APN	1	185411375	splice site	probably benign
IGL01608:Eprs	APN	1	185385114	unclassified	probably benign
IGL01767:Eprs	APN	1	185384915	missense	probably damaging	0.98
IGL02136:Eprs	APN	1	185384983	missense	probably damaging	1.00
IGL02302:Eprs	APN	1	185387124	splice site	probably benign
IGL02528:Eprs	APN	1	185413489	missense	probably damaging	1.00
IGL02631:Eprs	APN	1	185427898	missense	probably damaging	1.00
IGL02989:Eprs	APN	1	185418366	missense	probably benign	0.31
IGL03004:Eprs	APN	1	185381833	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0003:Eprs	UTSW	1	185414391	missense	probably damaging	1.00
R0179:Eprs	UTSW	1	185413547	missense	probably benign
R0783:Eprs	UTSW	1	185398458	missense	probably damaging	1.00
R1319:Eprs	UTSW	1	185384962	missense	probably damaging	1.00
R1335:Eprs	UTSW	1	185387089	missense	probably damaging	1.00
R1514:Eprs	UTSW	1	185381834	missense	probably damaging	0.99
R1590:Eprs	UTSW	1	185401510	missense	probably damaging	1.00
R1688:Eprs	UTSW	1	185384896	missense	probably damaging	0.99
R1725:Eprs	UTSW	1	185406992	missense	probably damaging	1.00
R2182:Eprs	UTSW	1	185379742	splice site	probably null
R2228:Eprs	UTSW	1	185367537	missense	probably damaging	1.00
R2336:Eprs	UTSW	1	185411374	splice site	probably benign
R2338:Eprs	UTSW	1	185415808	missense	probably damaging	1.00
R2439:Eprs	UTSW	1	185379742	splice site	probably null
R2914:Eprs	UTSW	1	185379742	splice site	probably null
R3001:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3002:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3003:Eprs	UTSW	1	185424391	critical splice donor site	probably null
R3547:Eprs	UTSW	1	185379742	splice site	probably null
R3775:Eprs	UTSW	1	185373008	missense	probably damaging	1.00
R3878:Eprs	UTSW	1	185415953	critical splice donor site	probably null
R3902:Eprs	UTSW	1	185379742	splice site	probably null
R3913:Eprs	UTSW	1	185379742	splice site	probably null
R4579:Eprs	UTSW	1	185401607	missense	probably damaging	1.00
R4664:Eprs	UTSW	1	185373076	intron	probably benign
R4680:Eprs	UTSW	1	185386278	missense	possibly damaging	0.87
R4712:Eprs	UTSW	1	185428108	missense	probably benign	0.00
R4749:Eprs	UTSW	1	185396130	missense	probably damaging	0.97
R4995:Eprs	UTSW	1	185410139	intron	probably benign
R5154:Eprs	UTSW	1	185413465	missense	probably damaging	1.00
R5640:Eprs	UTSW	1	185374184	missense	probably benign	0.34
R5662:Eprs	UTSW	1	185394425	missense	possibly damaging	0.72
R6037:Eprs	UTSW	1	185396109	missense	probably damaging	1.00
R6151:Eprs	UTSW	1	185407754	critical splice donor site	probably null
R6387:Eprs	UTSW	1	185387084	missense	possibly damaging	0.94
R6647:Eprs	UTSW	1	185414424	missense	probably damaging	1.00
R6701:Eprs	UTSW	1	185370890	missense	probably damaging	0.99
R6997:Eprs	UTSW	1	185396163	missense	possibly damaging	0.50
R7295:Eprs	UTSW	1	185418210	critical splice acceptor site	probably null
R7305:Eprs	UTSW	1	185379701	missense	probably damaging	1.00
R7729:Eprs	UTSW	1	185413169	missense	probably damaging	1.00
R7732:Eprs	UTSW	1	185372939	missense	probably benign	0.01
R7733:Eprs	UTSW	1	185397161	missense	probably benign
R7826:Eprs	UTSW	1	185406968	missense	probably damaging	0.96
R7988:Eprs	UTSW	1	185418348	missense	probably damaging	1.00
R8071:Eprs	UTSW	1	185394456	missense	possibly damaging	0.67
R8157:Eprs	UTSW	1	185398394	missense	probably benign	0.21
R8209:Eprs	UTSW	1	185407615	missense	possibly damaging	0.71
R8370:Eprs	UTSW	1	185399257	missense	probably damaging	0.98
R8493:Eprs	UTSW	1	185407174	nonsense	probably null
R8556:Eprs	UTSW	1	185420288	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTAAAACTTACCTGCCTTTCCTAG -3'
(R):5'- ATTAGTCAGGAGCACCAGTGTC -3'

Sequencing Primer
(F):5'- TGTTTGTTTAAAGAGCACAGTGC -3'
(R):5'- TCAAGGACTTCAATCAGGGTCTG -3'

Posted On

2017-08-16