Incidental Mutation 'R6037:Zeb2'
ID486613
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 44988640 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 1170 (S1170*)
Ref Sequence ENSEMBL: ENSMUSP00000144421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844]
Predicted Effect probably null
Transcript: ENSMUST00000028229
AA Change: S1238*
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: S1238*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068415
AA Change: S1194*
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: S1194*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076836
AA Change: S1193*
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: S1193*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176438
AA Change: S1194*
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: S1194*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177302
AA Change: S1194*
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: S1194*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200844
AA Change: S1170*
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: S1170*

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCTACAGCTTCCTGGAAG -3'
(R):5'- CTTACCTGCAGAGCATCACC -3'

Sequencing Primer
(F):5'- TTCCTGGAAGCGTCAGGC -3'
(R):5'- TCAGGGGTACTCTGACTCG -3'
Posted On2017-08-16