Incidental Mutation 'R6037:Olfr1066'
ID486615
Institutional Source Beutler Lab
Gene Symbol Olfr1066
Ensembl Gene ENSMUSG00000075181
Gene Nameolfactory receptor 1066
SynonymsMOR256-52P, GA_x6K02T2Q125-47925557-47924616, MOR188-8
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86455328-86456269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86455789 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 161 (I161L)
Ref Sequence ENSEMBL: ENSMUSP00000097470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099885]
Predicted Effect probably benign
Transcript: ENSMUST00000099885
AA Change: I161L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097470
Gene: ENSMUSG00000075181
AA Change: I161L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Olfr1066
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr1066 APN 2 86455502 missense possibly damaging 0.92
IGL01668:Olfr1066 APN 2 86455402 missense probably damaging 1.00
IGL02016:Olfr1066 APN 2 86455497 missense probably damaging 0.99
R0396:Olfr1066 UTSW 2 86456019 missense possibly damaging 0.54
R0980:Olfr1066 UTSW 2 86455360 missense probably benign 0.01
R0987:Olfr1066 UTSW 2 86455547 nonsense probably null
R1169:Olfr1066 UTSW 2 86455587 missense possibly damaging 0.85
R2001:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2002:Olfr1066 UTSW 2 86455473 missense probably benign 0.45
R2265:Olfr1066 UTSW 2 86456214 missense possibly damaging 0.77
R3811:Olfr1066 UTSW 2 86455347 missense probably benign 0.21
R4579:Olfr1066 UTSW 2 86455515 missense probably damaging 0.99
R4726:Olfr1066 UTSW 2 86456236 missense possibly damaging 0.90
R4768:Olfr1066 UTSW 2 86455650 nonsense probably null
R4871:Olfr1066 UTSW 2 86455809 missense possibly damaging 0.95
R5304:Olfr1066 UTSW 2 86455435 missense probably damaging 1.00
R6037:Olfr1066 UTSW 2 86455789 missense probably benign 0.14
R7080:Olfr1066 UTSW 2 86455491 nonsense probably null
R7223:Olfr1066 UTSW 2 86455867 missense possibly damaging 0.78
R7378:Olfr1066 UTSW 2 86456068 missense probably benign 0.10
R7465:Olfr1066 UTSW 2 86455806 missense probably benign 0.07
R7598:Olfr1066 UTSW 2 86455890 missense probably damaging 0.98
X0025:Olfr1066 UTSW 2 86455869 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCTTCCATTTACCCTCAGTAGAG -3'
(R):5'- TTATTCAACAGCTGTGGGACC -3'

Sequencing Primer
(F):5'- CCATTTACCCTCAGTAGAGTTAATCC -3'
(R):5'- TTCAACAGCTGTGGGACCAAAAATG -3'
Posted On2017-08-16