Incidental Mutation 'R6037:Fry'
ID486621
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150428179 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1716 (M1716K)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
AA Change: M1716K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: M1716K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201634
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R8058:Fry UTSW 5 150495767 missense not run
R8070:Fry UTSW 5 150478007 missense not run
Z1177:Fry UTSW 5 150310437 missense not run
Predicted Primers PCR Primer
(F):5'- TTTCTCCCAGCATCCCAGAG -3'
(R):5'- GCCATGAAAAGGTGCTTTGGAG -3'

Sequencing Primer
(F):5'- TTCGCTATCCACAGAATCTCAGTGAG -3'
(R):5'- CTTTGGAGGCATGTTACACGAAAC -3'
Posted On2017-08-16