Mutagenetix > Incidental Mutations

Incidental Mutation 'R6037:Il23r'

486622

Institutional Source

Beutler Lab

Gene Symbol

Il23r

Ensembl Gene

ENSMUSG00000049093

Gene Name

interleukin 23 receptor

Synonyms

MMRRC Submission

043258-MU

Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67422932-67491855 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 67478954 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 177 (V177M)

Ref Sequence

ENSEMBL: ENSMUSP00000113342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118364]

Predicted Effect

probably damaging
Transcript: ENSMUST00000118364
AA Change: V177M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: V177M

Domain	Start	End	E-Value	Type
FN3	140	220	1e-1	SMART
Blast:FN3	235	317	2e-38	BLAST
transmembrane domain	388	410	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abi2	C	A	1: 60,464,579	P212T	probably damaging	Het
Ano4	A	G	10: 89,317,246	F68S	possibly damaging	Het
Art5	C	A	7: 102,098,384	A63S	probably benign	Het
Asgr1	T	A	11: 70,056,421	S96R	probably benign	Het
Bdp1	A	T	13: 100,027,449	V2248D	possibly damaging	Het
Cacna1s	C	T	1: 136,070,967	A200V	possibly damaging	Het
Cacna2d2	A	G	9: 107,513,539	K357E	probably damaging	Het
Cfap52	C	T	11: 67,946,300	G212R	probably benign	Het
Dcun1d3	A	G	7: 119,857,742	F249S	probably damaging	Het
Ece2	A	G	16: 20,630,362	Y17C	probably damaging	Het
Efemp1	C	T	11: 28,921,760	T425I	probably damaging	Het
Eprs	A	G	1: 185,396,109	E562G	probably damaging	Het
Fbn2	T	C	18: 58,044,223	T2001A	probably benign	Het
Flt4	G	A	11: 49,637,040	R940H	probably damaging	Het
Fry	T	A	5: 150,428,179	M1716K	probably benign	Het
Gm10684	T	A	9: 45,107,741		probably benign	Het
Gm281	T	C	14: 13,864,282	N348S	probably damaging	Het
Hivep1	G	A	13: 42,157,940	V1219I	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Klf12	T	C	14: 99,900,214	S299G	probably benign	Het
Lama5	G	A	2: 180,207,013	R265C	probably damaging	Het
Lifr	A	G	15: 7,186,943	T800A	probably damaging	Het
Megf8	T	C	7: 25,364,406	L2729P	probably damaging	Het
Mki67	A	C	7: 135,696,803	S2167R	possibly damaging	Het
Mus81	T	C	19: 5,484,004	K400E	probably damaging	Het
Nomo1	T	A	7: 46,062,999	I656N	possibly damaging	Het
Oas3	T	C	5: 120,769,319	T418A	probably benign	Het
Olfr1034	T	C	2: 86,046,584	M34T	probably benign	Het
Olfr1066	T	A	2: 86,455,789	I161L	probably benign	Het
Olfr147	T	A	9: 38,403,305	C144S	probably benign	Het
Olfr301	C	T	7: 86,413,270	L303F	probably benign	Het
Olfr936	A	G	9: 39,047,107	V104A	probably damaging	Het
Olr1	A	G	6: 129,493,541	L221P	probably damaging	Het
Pih1d1	C	T	7: 45,156,314	A69V	probably damaging	Het
Pkdrej	A	C	15: 85,819,766	S656R	probably damaging	Het
Polr3f	A	G	2: 144,536,023	D171G	probably damaging	Het
Rasal1	T	C	5: 120,649,501	V11A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Sptbn4	T	A	7: 27,364,170	Y2277F	probably damaging	Het
St6galnac6	A	G	2: 32,612,228	Q7R	probably damaging	Het
Thrsp	T	G	7: 97,417,292	D71A	possibly damaging	Het
Vmn2r1	C	A	3: 64,081,729	Q30K	probably benign	Het
Wipf2	C	T	11: 98,896,179	P345S	probably benign	Het
Zeb2	G	T	2: 44,988,640	S1170*	probably null	Het
Zfp947	A	G	17: 22,147,434	Y38H	probably damaging	Het

Other mutations in Il23r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Il23r	APN	6	67423628	missense	probably damaging	0.96
IGL00886:Il23r	APN	6	67473890	missense	possibly damaging	0.94
IGL00916:Il23r	APN	6	67473931	missense	probably damaging	1.00
IGL01102:Il23r	APN	6	67423925	missense	probably damaging	0.98
IGL01466:Il23r	APN	6	67426642	missense	probably benign	0.30
IGL01627:Il23r	APN	6	67423428	missense	probably benign	0.17
IGL02160:Il23r	APN	6	67423578	missense	probably benign	0.09
IGL02394:Il23r	APN	6	67466272	splice site	probably benign
IGL02418:Il23r	APN	6	67490672	missense	possibly damaging	0.46
IGL02818:Il23r	APN	6	67486094	critical splice donor site	probably null
IGL03230:Il23r	APN	6	67423964	missense	probably benign	0.31
R0029:Il23r	UTSW	6	67478945	critical splice donor site	probably null
R0029:Il23r	UTSW	6	67478945	critical splice donor site	probably null
R0035:Il23r	UTSW	6	67473788	splice site	probably benign
R0035:Il23r	UTSW	6	67473788	splice site	probably benign
R0085:Il23r	UTSW	6	67486222	missense	probably damaging	1.00
R0477:Il23r	UTSW	6	67452377	missense	probably benign	0.00
R0534:Il23r	UTSW	6	67426588	missense	probably benign	0.00
R0547:Il23r	UTSW	6	67423701	missense	probably benign	0.05
R0547:Il23r	UTSW	6	67486251	missense	possibly damaging	0.57
R0666:Il23r	UTSW	6	67434680	missense	probably benign	0.08
R0702:Il23r	UTSW	6	67466285	missense	probably damaging	0.97
R0715:Il23r	UTSW	6	67486333	missense	possibly damaging	0.63
R1077:Il23r	UTSW	6	67473810	missense	probably benign	0.40
R1202:Il23r	UTSW	6	67478953	missense	possibly damaging	0.95
R1328:Il23r	UTSW	6	67491818	start gained	probably benign
R1378:Il23r	UTSW	6	67452410	missense	possibly damaging	0.68
R1420:Il23r	UTSW	6	67486197	missense	probably damaging	1.00
R1475:Il23r	UTSW	6	67452296	critical splice donor site	probably null
R1628:Il23r	UTSW	6	67423609	missense	probably damaging	1.00
R1745:Il23r	UTSW	6	67466291	missense	probably damaging	0.98
R1887:Il23r	UTSW	6	67473801	missense	possibly damaging	0.88
R1901:Il23r	UTSW	6	67423734	missense	probably benign	0.44
R1902:Il23r	UTSW	6	67423734	missense	probably benign	0.44
R1928:Il23r	UTSW	6	67423735	missense	possibly damaging	0.79
R1984:Il23r	UTSW	6	67490668	splice site	probably null
R1985:Il23r	UTSW	6	67490668	splice site	probably null
R2264:Il23r	UTSW	6	67426667	critical splice acceptor site	probably null
R2290:Il23r	UTSW	6	67423861	missense	probably benign	0.17
R2363:Il23r	UTSW	6	67452417	missense	probably benign	0.08
R3430:Il23r	UTSW	6	67452474	missense	probably benign	0.08
R3964:Il23r	UTSW	6	67466297	missense	probably benign	0.13
R4073:Il23r	UTSW	6	67486122	missense	probably damaging	1.00
R4164:Il23r	UTSW	6	67423663	missense	probably benign	0.00
R4643:Il23r	UTSW	6	67423993	missense	probably benign	0.08
R4700:Il23r	UTSW	6	67473850	missense	probably damaging	1.00
R4703:Il23r	UTSW	6	67490702	missense	probably damaging	1.00
R4720:Il23r	UTSW	6	67423661	missense	probably damaging	1.00
R4828:Il23r	UTSW	6	67431651	missense	probably benign	0.31
R4911:Il23r	UTSW	6	67423561	missense	probably benign	0.17
R5119:Il23r	UTSW	6	67466316	missense	probably damaging	1.00
R5152:Il23r	UTSW	6	67423741	missense	probably damaging	0.98
R5223:Il23r	UTSW	6	67486170	missense	probably benign	0.23
R5271:Il23r	UTSW	6	67423696	missense	probably benign	0.16
R5330:Il23r	UTSW	6	67423495	missense	probably damaging	1.00
R5331:Il23r	UTSW	6	67423495	missense	probably damaging	1.00
R5384:Il23r	UTSW	6	67486291	missense	probably benign	0.10
R5874:Il23r	UTSW	6	67431645	missense	possibly damaging	0.92
R6037:Il23r	UTSW	6	67478954	missense	probably damaging	0.99
R6377:Il23r	UTSW	6	67423652	missense	probably damaging	0.99
R6925:Il23r	UTSW	6	67423493	missense	probably damaging	1.00
R6975:Il23r	UTSW	6	67423368	missense	probably damaging	1.00
R7529:Il23r	UTSW	6	67490736	missense	possibly damaging	0.84
R7757:Il23r	UTSW	6	67423981	missense	probably benign	0.02
R7832:Il23r	UTSW	6	67423862	missense	probably benign	0.08
R7946:Il23r	UTSW	6	67434664	missense	possibly damaging	0.69
R8078:Il23r	UTSW	6	67423593	missense	probably damaging	0.99
R8391:Il23r	UTSW	6	67452390	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CATTAGGCTCCTGATACCAAGAG -3'
(R):5'- TGGGTTCTCAGTGCCAAGAG -3'

Sequencing Primer
(F):5'- TTAGGCTCCTGATACCAAGAGAAAAG -3'
(R):5'- AAGAGGCCTAGTTTGTTTCCC -3'

Posted On

2017-08-16