Incidental Mutation 'R6037:Olfr301'
ID486628
Institutional Source Beutler Lab
Gene Symbol Olfr301
Ensembl Gene ENSMUSG00000061549
Gene Nameolfactory receptor 301
SynonymsOlfr1531-ps1, MOR211-8P, GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR221-1P, MOR221-4
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86403846-86414024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86413270 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 303 (L303F)
Ref Sequence ENSEMBL: ENSMUSP00000133780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174362]
Predicted Effect probably benign
Transcript: ENSMUST00000174362
AA Change: L303F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133780
Gene: ENSMUSG00000061549
AA Change: L303F

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
Pfam:7tm_1 39 289 2e-28 PFAM
Pfam:7tm_4 137 282 1.1e-40 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Olfr301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr301 APN 7 86412790 missense probably damaging 1.00
IGL01459:Olfr301 APN 7 86412551 missense probably damaging 1.00
IGL01538:Olfr301 APN 7 86412959 missense possibly damaging 0.80
IGL01547:Olfr301 APN 7 86412871 missense possibly damaging 0.94
R0918:Olfr301 UTSW 7 86413195 missense probably benign 0.01
R1559:Olfr301 UTSW 7 86412367 missense probably benign 0.00
R1651:Olfr301 UTSW 7 86407870 utr 5 prime probably benign
R2411:Olfr301 UTSW 7 86413082 missense possibly damaging 0.51
R3732:Olfr301 UTSW 7 86412633 missense probably damaging 0.98
R3832:Olfr301 UTSW 7 86413193 missense probably damaging 1.00
R5175:Olfr301 UTSW 7 86413046 missense probably benign 0.00
R5372:Olfr301 UTSW 7 86412968 missense possibly damaging 0.66
R5413:Olfr301 UTSW 7 86412467 missense probably benign
R5520:Olfr301 UTSW 7 86412856 missense probably benign 0.02
R5579:Olfr301 UTSW 7 86412726 nonsense probably null
R6037:Olfr301 UTSW 7 86413270 missense probably benign 0.02
R7251:Olfr301 UTSW 7 86413001 missense probably benign
R7340:Olfr301 UTSW 7 86412749 missense possibly damaging 0.92
R7860:Olfr301 UTSW 7 86407911 start gained probably benign
R8305:Olfr301 UTSW 7 86412779 missense probably damaging 1.00
R8338:Olfr301 UTSW 7 86412494 missense probably benign 0.14
Z1176:Olfr301 UTSW 7 86412698 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAAGGCCTTTTCCACCTGTGTC -3'
(R):5'- CAACGCCTGTATCTGATTTGTG -3'

Sequencing Primer
(F):5'- ACATTATTGTGGTGTCTGTCTTTC -3'
(R):5'- TGCACTAATCTGATGCATTTGG -3'
Posted On2017-08-16