Mutagenetix > Incidental Mutations

Incidental Mutation 'R6037:Olfr301'

486628

Institutional Source

Beutler Lab

Gene Symbol

Olfr301

Ensembl Gene

ENSMUSG00000061549

Gene Name

olfactory receptor 301

Synonyms

Olfr1531-ps1, MOR211-8P, GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR221-1P, MOR221-4

MMRRC Submission

043258-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R6037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86403846-86414024 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86413270 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 303 (L303F)

Ref Sequence

ENSEMBL: ENSMUSP00000133780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000174362]

Predicted Effect

probably benign
Transcript: ENSMUST00000174362
AA Change: L303F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000133780
Gene: ENSMUSG00000061549
AA Change: L303F

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
Pfam:7tm_1	39	289	2e-28	PFAM
Pfam:7tm_4	137	282	1.1e-40	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abi2	C	A	1: 60,464,579	P212T	probably damaging	Het
Ano4	A	G	10: 89,317,246	F68S	possibly damaging	Het
Art5	C	A	7: 102,098,384	A63S	probably benign	Het
Asgr1	T	A	11: 70,056,421	S96R	probably benign	Het
Bdp1	A	T	13: 100,027,449	V2248D	possibly damaging	Het
Cacna1s	C	T	1: 136,070,967	A200V	possibly damaging	Het
Cacna2d2	A	G	9: 107,513,539	K357E	probably damaging	Het
Cfap52	C	T	11: 67,946,300	G212R	probably benign	Het
Dcun1d3	A	G	7: 119,857,742	F249S	probably damaging	Het
Ece2	A	G	16: 20,630,362	Y17C	probably damaging	Het
Efemp1	C	T	11: 28,921,760	T425I	probably damaging	Het
Eprs	A	G	1: 185,396,109	E562G	probably damaging	Het
Fbn2	T	C	18: 58,044,223	T2001A	probably benign	Het
Flt4	G	A	11: 49,637,040	R940H	probably damaging	Het
Fry	T	A	5: 150,428,179	M1716K	probably benign	Het
Gm10684	T	A	9: 45,107,741		probably benign	Het
Gm281	T	C	14: 13,864,282	N348S	probably damaging	Het
Hivep1	G	A	13: 42,157,940	V1219I	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Il23r	C	T	6: 67,478,954	V177M	probably damaging	Het
Klf12	T	C	14: 99,900,214	S299G	probably benign	Het
Lama5	G	A	2: 180,207,013	R265C	probably damaging	Het
Lifr	A	G	15: 7,186,943	T800A	probably damaging	Het
Megf8	T	C	7: 25,364,406	L2729P	probably damaging	Het
Mki67	A	C	7: 135,696,803	S2167R	possibly damaging	Het
Mus81	T	C	19: 5,484,004	K400E	probably damaging	Het
Nomo1	T	A	7: 46,062,999	I656N	possibly damaging	Het
Oas3	T	C	5: 120,769,319	T418A	probably benign	Het
Olfr1034	T	C	2: 86,046,584	M34T	probably benign	Het
Olfr1066	T	A	2: 86,455,789	I161L	probably benign	Het
Olfr147	T	A	9: 38,403,305	C144S	probably benign	Het
Olfr936	A	G	9: 39,047,107	V104A	probably damaging	Het
Olr1	A	G	6: 129,493,541	L221P	probably damaging	Het
Pih1d1	C	T	7: 45,156,314	A69V	probably damaging	Het
Pkdrej	A	C	15: 85,819,766	S656R	probably damaging	Het
Polr3f	A	G	2: 144,536,023	D171G	probably damaging	Het
Rasal1	T	C	5: 120,649,501	V11A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Sptbn4	T	A	7: 27,364,170	Y2277F	probably damaging	Het
St6galnac6	A	G	2: 32,612,228	Q7R	probably damaging	Het
Thrsp	T	G	7: 97,417,292	D71A	possibly damaging	Het
Vmn2r1	C	A	3: 64,081,729	Q30K	probably benign	Het
Wipf2	C	T	11: 98,896,179	P345S	probably benign	Het
Zeb2	G	T	2: 44,988,640	S1170*	probably null	Het
Zfp947	A	G	17: 22,147,434	Y38H	probably damaging	Het

Other mutations in Olfr301

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01015:Olfr301	APN	7	86412790	missense	probably damaging	1.00
IGL01459:Olfr301	APN	7	86412551	missense	probably damaging	1.00
IGL01538:Olfr301	APN	7	86412959	missense	possibly damaging	0.80
IGL01547:Olfr301	APN	7	86412871	missense	possibly damaging	0.94
R0918:Olfr301	UTSW	7	86413195	missense	probably benign	0.01
R1559:Olfr301	UTSW	7	86412367	missense	probably benign	0.00
R1651:Olfr301	UTSW	7	86407870	utr 5 prime	probably benign
R2411:Olfr301	UTSW	7	86413082	missense	possibly damaging	0.51
R3732:Olfr301	UTSW	7	86412633	missense	probably damaging	0.98
R3832:Olfr301	UTSW	7	86413193	missense	probably damaging	1.00
R5175:Olfr301	UTSW	7	86413046	missense	probably benign	0.00
R5372:Olfr301	UTSW	7	86412968	missense	possibly damaging	0.66
R5413:Olfr301	UTSW	7	86412467	missense	probably benign
R5520:Olfr301	UTSW	7	86412856	missense	probably benign	0.02
R5579:Olfr301	UTSW	7	86412726	nonsense	probably null
R6037:Olfr301	UTSW	7	86413270	missense	probably benign	0.02
R7251:Olfr301	UTSW	7	86413001	missense	probably benign
R7340:Olfr301	UTSW	7	86412749	missense	possibly damaging	0.92
R7860:Olfr301	UTSW	7	86407911	start gained	probably benign
R7943:Olfr301	UTSW	7	86407911	start gained	probably benign
Z1176:Olfr301	UTSW	7	86412698	missense	not run

Predicted Primers

PCR Primer
(F):5'- GAAGGCCTTTTCCACCTGTGTC -3'
(R):5'- CAACGCCTGTATCTGATTTGTG -3'

Sequencing Primer
(F):5'- ACATTATTGTGGTGTCTGTCTTTC -3'
(R):5'- TGCACTAATCTGATGCATTTGG -3'

Posted On

2017-08-16