Incidental Mutation 'R6037:Thrsp'
ID486629
Institutional Source Beutler Lab
Gene Symbol Thrsp
Ensembl Gene ENSMUSG00000035686
Gene Namethyroid hormone responsive
SynonymsSpot 14, S14
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location97412938-97417730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 97417292 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 71 (D71A)
Ref Sequence ENSEMBL: ENSMUSP00000042988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043077]
PDB Structure
The Crystal Structure of Spot14, a modulator of lipogenesis [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043077
AA Change: D71A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042988
Gene: ENSMUSG00000035686
AA Change: D71A

DomainStartEndE-ValueType
Pfam:Spot_14 1 149 2.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206613
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the gene product of S14, a rat gene whose expression is limited to liver and adipose tissue and is controlled by nutritional and hormonal factors. This gene has been shown to be expressed in liver and adipocytes, particularly in lipomatous modules. It is also found to be expressed in lipogenic breast cancers, which suggests a role in controlling tumor lipid metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride during lactation and in milk produced as well as decreased de novo lipid biosynthesis in mammary tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Thrsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0276:Thrsp UTSW 7 97417502 start codon destroyed probably null 1.00
R0454:Thrsp UTSW 7 97417427 missense probably damaging 1.00
R1809:Thrsp UTSW 7 97417125 missense probably benign 0.15
R6037:Thrsp UTSW 7 97417292 missense possibly damaging 0.86
R7241:Thrsp UTSW 7 97417088 missense probably damaging 0.98
R7602:Thrsp UTSW 7 97417307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCTGCCCTGTCATTTC -3'
(R):5'- ACTGCCTGCTGACAGTCATG -3'

Sequencing Primer
(F):5'- CCTGTGCTTTCCGGGTCAG -3'
(R):5'- CTGACAGTCATGGATCGGTACTC -3'
Posted On2017-08-16