Mutagenetix > Incidental Mutations

Incidental Mutation 'R6037:Mki67'

486633

Institutional Source

Beutler Lab

Gene Symbol

Mki67

Ensembl Gene

ENSMUSG00000031004

Gene Name

antigen identified by monoclonal antibody Ki 67

Synonyms

D630048A14Rik, Ki-67, Ki67

MMRRC Submission

043258-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.819) question?

Stock #

R6037 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135689784-135716361 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 135696803 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 2167 (S2167R)

Ref Sequence

ENSEMBL: ENSMUSP00000033310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033310]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033310
AA Change: S2167R

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: S2167R

Domain	Start	End	E-Value	Type
FHA	26	76	1.03e-11	SMART
Pfam:PP1_bind	462	519	2.8e-20	PFAM
low complexity region	535	545	N/A	INTRINSIC
low complexity region	869	882	N/A	INTRINSIC
Pfam:K167R	889	982	1.5e-9	PFAM
K167R	993	1102	2.01e-39	SMART
K167R	1107	1217	1.87e-57	SMART
K167R	1228	1337	1.33e-53	SMART
K167R	1348	1451	6.57e-44	SMART
K167R	1462	1570	9.09e-38	SMART
K167R	1580	1686	5.02e-40	SMART
K167R	1697	1807	9.6e-37	SMART
K167R	1818	1926	5.94e-51	SMART
K167R	1937	2047	1.6e-56	SMART
K167R	2058	2164	4.04e-53	SMART
K167R	2175	2285	1.52e-57	SMART
K167R	2296	2407	1.78e-40	SMART
K167R	2418	2527	1.71e-42	SMART
K167R	2538	2640	7.41e-20	SMART
K167R	2642	2750	1.06e-38	SMART
K167R	2761	2872	2.1e-42	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abi2	C	A	1: 60,464,579	P212T	probably damaging	Het
Ano4	A	G	10: 89,317,246	F68S	possibly damaging	Het
Art5	C	A	7: 102,098,384	A63S	probably benign	Het
Asgr1	T	A	11: 70,056,421	S96R	probably benign	Het
Bdp1	A	T	13: 100,027,449	V2248D	possibly damaging	Het
Cacna1s	C	T	1: 136,070,967	A200V	possibly damaging	Het
Cacna2d2	A	G	9: 107,513,539	K357E	probably damaging	Het
Cfap52	C	T	11: 67,946,300	G212R	probably benign	Het
Dcun1d3	A	G	7: 119,857,742	F249S	probably damaging	Het
Ece2	A	G	16: 20,630,362	Y17C	probably damaging	Het
Efemp1	C	T	11: 28,921,760	T425I	probably damaging	Het
Eprs	A	G	1: 185,396,109	E562G	probably damaging	Het
Fbn2	T	C	18: 58,044,223	T2001A	probably benign	Het
Flt4	G	A	11: 49,637,040	R940H	probably damaging	Het
Fry	T	A	5: 150,428,179	M1716K	probably benign	Het
Gm10684	T	A	9: 45,107,741		probably benign	Het
Gm281	T	C	14: 13,864,282	N348S	probably damaging	Het
Hivep1	G	A	13: 42,157,940	V1219I	probably damaging	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Il23r	C	T	6: 67,478,954	V177M	probably damaging	Het
Klf12	T	C	14: 99,900,214	S299G	probably benign	Het
Lama5	G	A	2: 180,207,013	R265C	probably damaging	Het
Lifr	A	G	15: 7,186,943	T800A	probably damaging	Het
Megf8	T	C	7: 25,364,406	L2729P	probably damaging	Het
Mus81	T	C	19: 5,484,004	K400E	probably damaging	Het
Nomo1	T	A	7: 46,062,999	I656N	possibly damaging	Het
Oas3	T	C	5: 120,769,319	T418A	probably benign	Het
Olfr1034	T	C	2: 86,046,584	M34T	probably benign	Het
Olfr1066	T	A	2: 86,455,789	I161L	probably benign	Het
Olfr147	T	A	9: 38,403,305	C144S	probably benign	Het
Olfr301	C	T	7: 86,413,270	L303F	probably benign	Het
Olfr936	A	G	9: 39,047,107	V104A	probably damaging	Het
Olr1	A	G	6: 129,493,541	L221P	probably damaging	Het
Pih1d1	C	T	7: 45,156,314	A69V	probably damaging	Het
Pkdrej	A	C	15: 85,819,766	S656R	probably damaging	Het
Polr3f	A	G	2: 144,536,023	D171G	probably damaging	Het
Rasal1	T	C	5: 120,649,501	V11A	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Sptbn4	T	A	7: 27,364,170	Y2277F	probably damaging	Het
St6galnac6	A	G	2: 32,612,228	Q7R	probably damaging	Het
Thrsp	T	G	7: 97,417,292	D71A	possibly damaging	Het
Vmn2r1	C	A	3: 64,081,729	Q30K	probably benign	Het
Wipf2	C	T	11: 98,896,179	P345S	probably benign	Het
Zeb2	G	T	2: 44,988,640	S1170*	probably null	Het
Zfp947	A	G	17: 22,147,434	Y38H	probably damaging	Het

Other mutations in Mki67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Mki67	APN	7	135690120	missense	probably benign	0.32
IGL00264:Mki67	APN	7	135707820	nonsense	probably null
IGL00328:Mki67	APN	7	135696695	missense	probably benign	0.03
IGL00570:Mki67	APN	7	135708101	missense	possibly damaging	0.88
IGL00584:Mki67	APN	7	135695695	missense	probably damaging	1.00
IGL00756:Mki67	APN	7	135698731	missense	possibly damaging	0.76
IGL01063:Mki67	APN	7	135694922	missense	possibly damaging	0.93
IGL01112:Mki67	APN	7	135714016	missense	probably damaging	1.00
IGL01360:Mki67	APN	7	135705776	missense	probably damaging	1.00
IGL01457:Mki67	APN	7	135699546	missense	probably benign	0.00
IGL01686:Mki67	APN	7	135707813	missense	probably benign	0.00
IGL01731:Mki67	APN	7	135696549	missense	probably benign	0.03
IGL01775:Mki67	APN	7	135698276	missense	possibly damaging	0.71
IGL01806:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01860:Mki67	APN	7	135698957	missense	probably damaging	0.98
IGL01938:Mki67	APN	7	135694330	missense	probably benign	0.04
IGL02249:Mki67	APN	7	135700522	missense	possibly damaging	0.47
IGL02260:Mki67	APN	7	135701968	missense	probably benign	0.00
IGL02270:Mki67	APN	7	135698632	missense	probably damaging	1.00
IGL02406:Mki67	APN	7	135698793	missense	probably benign	0.00
IGL02499:Mki67	APN	7	135694327	missense	possibly damaging	0.94
IGL02655:Mki67	APN	7	135714019	missense	probably damaging	0.98
IGL02700:Mki67	APN	7	135708202	missense	probably benign	0.02
IGL03370:Mki67	APN	7	135695490	missense	probably benign	0.00
PIT4468001:Mki67	UTSW	7	135699147	missense	probably benign	0.00
R0001:Mki67	UTSW	7	135699172	missense	probably damaging	1.00
R0001:Mki67	UTSW	7	135701019	missense	probably damaging	0.99
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0043:Mki67	UTSW	7	135700581	missense	probably benign	0.16
R0102:Mki67	UTSW	7	135713803	missense	probably benign	0.16
R0130:Mki67	UTSW	7	135696459	missense	probably damaging	1.00
R0149:Mki67	UTSW	7	135698424	missense	probably benign	0.00
R0356:Mki67	UTSW	7	135704406	missense	probably benign	0.34
R0482:Mki67	UTSW	7	135699429	missense	possibly damaging	0.60
R0508:Mki67	UTSW	7	135700346	missense	probably benign
R0532:Mki67	UTSW	7	135698164	nonsense	probably null
R0548:Mki67	UTSW	7	135695256	missense	probably damaging	1.00
R0548:Mki67	UTSW	7	135696908	missense	possibly damaging	0.82
R0557:Mki67	UTSW	7	135699261	missense	possibly damaging	0.48
R0627:Mki67	UTSW	7	135708258	missense	probably benign	0.31
R0631:Mki67	UTSW	7	135704388	missense	probably damaging	0.98
R0848:Mki67	UTSW	7	135701043	missense	probably benign	0.21
R1075:Mki67	UTSW	7	135697311	missense	probably benign	0.03
R1105:Mki67	UTSW	7	135701050	missense	probably benign	0.09
R1272:Mki67	UTSW	7	135700414	nonsense	probably null
R1331:Mki67	UTSW	7	135698276	missense	possibly damaging	0.71
R1486:Mki67	UTSW	7	135699720	missense	probably benign	0.00
R1510:Mki67	UTSW	7	135696171	missense	probably benign	0.26
R1573:Mki67	UTSW	7	135695116	missense	possibly damaging	0.93
R1586:Mki67	UTSW	7	135713972	nonsense	probably null
R1599:Mki67	UTSW	7	135699934	missense	probably benign	0.34
R1623:Mki67	UTSW	7	135708818	splice site	probably null
R1706:Mki67	UTSW	7	135700566	missense	probably benign	0.37
R1718:Mki67	UTSW	7	135695494	missense	probably damaging	1.00
R1785:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R1816:Mki67	UTSW	7	135707387	missense	possibly damaging	0.68
R1862:Mki67	UTSW	7	135699361	missense	probably benign	0.09
R1929:Mki67	UTSW	7	135698065	missense	possibly damaging	0.46
R1957:Mki67	UTSW	7	135698399	missense	probably benign	0.01
R1971:Mki67	UTSW	7	135713959	critical splice donor site	probably null
R1998:Mki67	UTSW	7	135705770	missense	probably benign	0.00
R2004:Mki67	UTSW	7	135698509	nonsense	probably null
R2005:Mki67	UTSW	7	135698509	nonsense	probably null
R2006:Mki67	UTSW	7	135698509	nonsense	probably null
R2109:Mki67	UTSW	7	135697863	missense	probably damaging	1.00
R2130:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2131:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2133:Mki67	UTSW	7	135704241	critical splice acceptor site	probably null
R2140:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2141:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2142:Mki67	UTSW	7	135695592	missense	possibly damaging	0.94
R2284:Mki67	UTSW	7	135699945	missense	probably damaging	0.99
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2869:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2871:Mki67	UTSW	7	135708149	missense	probably benign	0.19
R2913:Mki67	UTSW	7	135700686	missense	possibly damaging	0.71
R3404:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3405:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3406:Mki67	UTSW	7	135707475	missense	probably benign	0.01
R3777:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3778:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3787:Mki67	UTSW	7	135700283	missense	possibly damaging	0.93
R3847:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3848:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3853:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3971:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R3972:Mki67	UTSW	7	135696130	missense	probably benign	0.10
R4258:Mki67	UTSW	7	135695288	missense	possibly damaging	0.86
R4343:Mki67	UTSW	7	135695118	missense	probably benign	0.10
R4488:Mki67	UTSW	7	135697671	missense	probably benign	0.01
R4528:Mki67	UTSW	7	135695359	missense	probably damaging	1.00
R4713:Mki67	UTSW	7	135695469	missense	probably benign	0.35
R4867:Mki67	UTSW	7	135699856	missense	probably damaging	0.97
R4874:Mki67	UTSW	7	135708771	missense	probably damaging	0.97
R4897:Mki67	UTSW	7	135696745	missense	probably damaging	1.00
R5045:Mki67	UTSW	7	135707904	missense	possibly damaging	0.84
R5306:Mki67	UTSW	7	135714001	missense	probably damaging	1.00
R5309:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5312:Mki67	UTSW	7	135700830	missense	probably damaging	1.00
R5379:Mki67	UTSW	7	135697461	missense	possibly damaging	0.95
R5506:Mki67	UTSW	7	135699981	missense	possibly damaging	0.60
R5513:Mki67	UTSW	7	135707750	missense	probably damaging	0.98
R5742:Mki67	UTSW	7	135704373	missense	probably benign	0.20
R5806:Mki67	UTSW	7	135704605	missense	probably damaging	1.00
R6008:Mki67	UTSW	7	135697429	missense	probably damaging	1.00
R6037:Mki67	UTSW	7	135696803	missense	possibly damaging	0.69
R6221:Mki67	UTSW	7	135697914	missense	probably benign	0.18
R6294:Mki67	UTSW	7	135704590	missense	probably benign	0.09
R6377:Mki67	UTSW	7	135696321	missense	possibly damaging	0.67
R6456:Mki67	UTSW	7	135699475	missense	possibly damaging	0.59
R6608:Mki67	UTSW	7	135698361	missense	probably benign	0.01
R6609:Mki67	UTSW	7	135699829	missense	possibly damaging	0.94
R6648:Mki67	UTSW	7	135697440	missense	probably damaging	1.00
R6901:Mki67	UTSW	7	135708760	splice site	probably null
R6978:Mki67	UTSW	7	135701962	missense	probably benign	0.10
R6985:Mki67	UTSW	7	135713865	missense	probably damaging	1.00
R7076:Mki67	UTSW	7	135705629	missense	probably damaging	0.98
R7217:Mki67	UTSW	7	135704182	missense	probably damaging	1.00
R7239:Mki67	UTSW	7	135700176	missense	possibly damaging	0.91
R7250:Mki67	UTSW	7	135699324	missense	possibly damaging	0.90
R7313:Mki67	UTSW	7	135694671	missense	probably benign	0.29
R7336:Mki67	UTSW	7	135713839	missense	probably benign	0.03
R7422:Mki67	UTSW	7	135698370	missense	probably damaging	1.00
R7451:Mki67	UTSW	7	135699351	missense	probably benign	0.01
R7502:Mki67	UTSW	7	135700783	missense	possibly damaging	0.53
R7513:Mki67	UTSW	7	135693223	missense	probably benign
R7578:Mki67	UTSW	7	135700915	missense	possibly damaging	0.68
R7619:Mki67	UTSW	7	135699377	missense	probably benign	0.01
R7646:Mki67	UTSW	7	135696769	missense	possibly damaging	0.63
R7659:Mki67	UTSW	7	135697426	missense	probably damaging	1.00
R7691:Mki67	UTSW	7	135701992	missense	not run
R7780:Mki67	UTSW	7	135713968	missense	probably benign	0.02
R7796:Mki67	UTSW	7	135698194	missense	probably damaging	1.00
X0020:Mki67	UTSW	7	135714001	missense	probably damaging	0.96
X0065:Mki67	UTSW	7	135713844	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCCATGAAGGCTGTGCTGTC -3'
(R):5'- TGGATGTGAGAGAAGACCCTTC -3'

Sequencing Primer
(F):5'- CATGAAGGCTGTGCTGTCATTTTC -3'
(R):5'- GTGAGAGAAGACCCTTCAATACTTG -3'

Posted On

2017-08-16