Incidental Mutation 'R6037:Hyls1'
ID486634
Institutional Source Beutler Lab
Gene Symbol Hyls1
Ensembl Gene ENSMUSG00000050555
Gene NameHYLS1, centriolar and ciliogenesis associated
Synonyms3010015K02Rik
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35560820-35570398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35561184 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 312 (S312F)
Ref Sequence ENSEMBL: ENSMUSP00000110762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612] [ENSMUST00000034615] [ENSMUST00000115110] [ENSMUST00000121246]
Predicted Effect probably benign
Transcript: ENSMUST00000034612
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034615
SMART Domains Protein: ENSMUSP00000034615
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 6.8e-12 PFAM
Pfam:PseudoU_synth_1 213 331 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115110
AA Change: S312F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110762
Gene: ENSMUSG00000050555
AA Change: S312F

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
Pfam:HYLS1_C 211 299 6.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121246
SMART Domains Protein: ENSMUSP00000113382
Gene: ENSMUSG00000032103

DomainStartEndE-ValueType
coiled coil region 1 46 N/A INTRINSIC
Pfam:PseudoU_synth_1 68 190 3e-12 PFAM
Pfam:PseudoU_synth_1 213 316 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135768
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized to the cytoplasm. Mutations in this gene are associated with hydrolethalus syndrome. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Hyls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Hyls1 APN 9 35561924 nonsense probably null
IGL00964:Hyls1 APN 9 35562112 intron probably benign
IGL01936:Hyls1 APN 9 35562067 missense probably benign
IGL02979:Hyls1 APN 9 35561674 missense probably benign 0.00
R0519:Hyls1 UTSW 9 35561203 missense probably damaging 1.00
R0894:Hyls1 UTSW 9 35561232 missense probably damaging 1.00
R2302:Hyls1 UTSW 9 35564069 missense possibly damaging 0.55
R3909:Hyls1 UTSW 9 35561409 missense probably damaging 1.00
R4111:Hyls1 UTSW 9 35561418 missense probably damaging 1.00
R4113:Hyls1 UTSW 9 35561418 missense probably damaging 1.00
R5725:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5727:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5833:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5834:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R5835:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6030:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6031:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6037:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6269:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6270:Hyls1 UTSW 9 35561184 missense probably benign 0.01
R6271:Hyls1 UTSW 9 35561184 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCAAATTCCAGTAGTTTTCCACC -3'
(R):5'- GTCCGAGGGCAAATGCTTTC -3'

Sequencing Primer
(F):5'- CCCTCACAATTGCTGTATTTGAG -3'
(R):5'- GAGGGCAAATGCTTTCCCGAAC -3'
Posted On2017-08-16