Incidental Mutation 'R6037:Olfr147'
ID486635
Institutional Source Beutler Lab
Gene Symbol Olfr147
Ensembl Gene ENSMUSG00000049098
Gene Nameolfactory receptor 147
SynonymsM3, GA_x6K02T2PVTD-32098059-32099003, MOR164-1
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38401698-38407997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38403305 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 144 (C144S)
Ref Sequence ENSEMBL: ENSMUSP00000051933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056364] [ENSMUST00000214648]
Predicted Effect probably benign
Transcript: ENSMUST00000056364
AA Change: C144S

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000051933
Gene: ENSMUSG00000049098
AA Change: C144S

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-48 PFAM
Pfam:7tm_1 44 292 2.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214648
AA Change: C141S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Olfr147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Olfr147 APN 9 38403021 missense possibly damaging 0.67
IGL02109:Olfr147 APN 9 38403086 missense possibly damaging 0.91
IGL02805:Olfr147 APN 9 38403836 utr 3 prime probably benign
IGL02875:Olfr147 APN 9 38403176 missense probably damaging 0.99
R1133:Olfr147 UTSW 9 38403731 missense probably benign 0.00
R1446:Olfr147 UTSW 9 38403305 missense possibly damaging 0.73
R1591:Olfr147 UTSW 9 38402936 missense probably damaging 1.00
R1719:Olfr147 UTSW 9 38403254 missense possibly damaging 0.67
R1895:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1946:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1981:Olfr147 UTSW 9 38403735 missense probably damaging 0.99
R2033:Olfr147 UTSW 9 38403373 missense probably damaging 0.99
R4856:Olfr147 UTSW 9 38403468 missense probably damaging 1.00
R5322:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
R6017:Olfr147 UTSW 9 38403620 missense probably benign 0.01
R6037:Olfr147 UTSW 9 38403305 missense probably benign 0.07
R7032:Olfr147 UTSW 9 38403669 missense possibly damaging 0.53
R7042:Olfr147 UTSW 9 38402900 missense probably damaging 0.98
R7351:Olfr147 UTSW 9 38403443 missense probably damaging 1.00
R7460:Olfr147 UTSW 9 38403353 missense possibly damaging 0.95
R7820:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTTCAGCCCCAAAATGC -3'
(R):5'- GGAACTGTGATGTTAATACCCACAAC -3'

Sequencing Primer
(F):5'- GCCCCAAAATGCTGATTAACTTTGTC -3'
(R):5'- GTGATGTTAATACCCACAACTATGAG -3'
Posted On2017-08-16