Incidental Mutation 'R6037:Olfr936'
ID486636
Institutional Source Beutler Lab
Gene Symbol Olfr936
Ensembl Gene ENSMUSG00000095194
Gene Nameolfactory receptor 936
SynonymsEG628171, GA_x6K02T2PVTD-32743332-32742397, MOR171-37
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39046614-39047549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39047107 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000137209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178303] [ENSMUST00000216912]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104850
Predicted Effect probably damaging
Transcript: ENSMUST00000178303
AA Change: V104A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137209
Gene: ENSMUSG00000095194
AA Change: V104A

DomainStartEndE-ValueType
Pfam:7tm_1 1 246 6e-21 PFAM
Pfam:7tm_4 1 264 6.9e-49 PFAM
Predicted Effect silent
Transcript: ENSMUST00000216912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Olfr936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Olfr936 APN 9 39047413 missense unknown
R0086:Olfr936 UTSW 9 39046895 missense probably benign 0.00
R0561:Olfr936 UTSW 9 39047373 missense probably damaging 0.99
R0650:Olfr936 UTSW 9 39046700 missense probably benign 0.01
R1221:Olfr936 UTSW 9 39047187 missense probably damaging 1.00
R1384:Olfr936 UTSW 9 39046904 missense possibly damaging 0.70
R1680:Olfr936 UTSW 9 39047000 missense probably benign 0.43
R1733:Olfr936 UTSW 9 39047382 missense unknown
R3767:Olfr936 UTSW 9 39047411 missense unknown
R4786:Olfr936 UTSW 9 39047487 nonsense probably null
R4944:Olfr936 UTSW 9 39046862 missense probably damaging 1.00
R5186:Olfr936 UTSW 9 39046969 nonsense probably null
R5403:Olfr936 UTSW 9 39046703 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6156:Olfr936 UTSW 9 39047375 missense possibly damaging 0.90
R6217:Olfr936 UTSW 9 39046743 makesense probably null
R6711:Olfr936 UTSW 9 39046866 makesense probably null
R6919:Olfr936 UTSW 9 39047531 utr 5 prime probably benign
R7022:Olfr936 UTSW 9 39047083 nonsense probably null
R7275:Olfr936 UTSW 9 39047519 utr 5 prime probably benign
R7290:Olfr936 UTSW 9 39047398 missense unknown
R7644:Olfr936 UTSW 9 39047342 missense probably damaging 1.00
Z1176:Olfr936 UTSW 9 39046919
Predicted Primers PCR Primer
(F):5'- GCGCAGGATGCTGATAATGATG -3'
(R):5'- TTCCTACCCTGAGTGCATAAC -3'

Sequencing Primer
(F):5'- AGGGTTGGGAAAATGGTATTAATTAG -3'
(R):5'- AGTGCATAACTCAACTTTGCTTC -3'
Posted On2017-08-16