Incidental Mutation 'R6037:Cfap52'
ID486643
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67946300 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 212 (G212R)
Ref Sequence ENSEMBL: ENSMUSP00000116496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000126766]
Predicted Effect probably benign
Transcript: ENSMUST00000021287
AA Change: G212R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: G212R

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126766
AA Change: G212R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116496
Gene: ENSMUSG00000020904
AA Change: G212R

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
Blast:WD40 190 233 4e-12 BLAST
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
Blast:WD40 321 342 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142929
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7914:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAATGGGACCTCTTAGCGCTTG -3'
(R):5'- CTGTCAGCTTCTCCTTCAAGAG -3'

Sequencing Primer
(F):5'- TGTGCTCCTTCCCAGCTGTG -3'
(R):5'- TCCTTCAAGAGGGGGTGAG -3'
Posted On2017-08-16