Incidental Mutation 'R6037:Wipf2'
ID486645
Institutional Source Beutler Lab
Gene Symbol Wipf2
Ensembl Gene ENSMUSG00000038013
Gene NameWAS/WASL interacting protein family, member 2
Synonyms
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98863638-98905040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98896179 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 345 (P345S)
Ref Sequence ENSEMBL: ENSMUSP00000046991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037480] [ENSMUST00000142414]
Predicted Effect probably benign
Transcript: ENSMUST00000037480
AA Change: P345S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046991
Gene: ENSMUSG00000038013
AA Change: P345S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
WH2 36 53 2.81e-4 SMART
low complexity region 69 80 N/A INTRINSIC
low complexity region 116 134 N/A INTRINSIC
low complexity region 173 192 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 353 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132006
Predicted Effect probably benign
Transcript: ENSMUST00000142414
SMART Domains Protein: ENSMUSP00000123244
Gene: ENSMUSG00000038013

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
WH2 36 53 2.81e-4 SMART
low complexity region 69 80 N/A INTRINSIC
low complexity region 116 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148439
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WASP interacting protein (WIP)-related protein. It has been shown that this protein has a role in the WASP-mediated organization of the actin cytoskeleton and that this protein is a potential link between the activated platelet-derived growth factor receptor and the actin polymerization machinery. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Wipf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wipf2 APN 11 98890803 missense possibly damaging 0.93
IGL01642:Wipf2 APN 11 98890824 missense probably benign 0.01
IGL03008:Wipf2 APN 11 98892728 unclassified probably benign
R0557:Wipf2 UTSW 11 98892089 missense possibly damaging 0.65
R1054:Wipf2 UTSW 11 98896315 missense possibly damaging 0.91
R1936:Wipf2 UTSW 11 98892410 nonsense probably null
R1937:Wipf2 UTSW 11 98892410 nonsense probably null
R1939:Wipf2 UTSW 11 98892410 nonsense probably null
R1940:Wipf2 UTSW 11 98892410 nonsense probably null
R2143:Wipf2 UTSW 11 98896214 missense possibly damaging 0.94
R2144:Wipf2 UTSW 11 98896214 missense possibly damaging 0.94
R2398:Wipf2 UTSW 11 98898717 splice site probably null
R2879:Wipf2 UTSW 11 98892654 missense probably benign 0.00
R4775:Wipf2 UTSW 11 98890732 missense probably benign 0.04
R6037:Wipf2 UTSW 11 98896179 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGCCGTGCATCTGTATCAC -3'
(R):5'- GAGTCGCCACCAGAACTAGTAG -3'

Sequencing Primer
(F):5'- GTGCATCTGTATCACTGGTCAC -3'
(R):5'- GTAGACAAAATCCCTAACTACTTACC -3'
Posted On2017-08-16