Incidental Mutation 'R6037:Klf12'
ID486649
Institutional Source Beutler Lab
Gene Symbol Klf12
Ensembl Gene ENSMUSG00000072294
Gene NameKruppel-like factor 12
Synonyms2700063E05Rik, D530033K05Rik, AP-2rep, B130052C06Rik
MMRRC Submission 043258-MU
Accession Numbers

Ncbi RefSeq: NM_010636.3; MGI:1333796

Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location99870632-100284679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99900214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 299 (S299G)
Ref Sequence ENSEMBL: ENSMUSP00000153901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097079] [ENSMUST00000228216]
Predicted Effect probably benign
Transcript: ENSMUST00000097079
AA Change: S299G

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094844
Gene: ENSMUSG00000072294
AA Change: S299G

DomainStartEndE-ValueType
low complexity region 89 145 N/A INTRINSIC
low complexity region 183 200 N/A INTRINSIC
ZnF_C2H2 317 341 9.58e-3 SMART
ZnF_C2H2 347 371 8.6e-5 SMART
ZnF_C2H2 377 399 9.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226205
Predicted Effect probably benign
Transcript: ENSMUST00000228216
AA Change: S299G

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228612
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(49) : Targeted(1) Gene trapped(48)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Klf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Klf12 APN 14 100149757 missense probably damaging 0.99
IGL01407:Klf12 APN 14 100109858 missense possibly damaging 0.72
IGL01621:Klf12 APN 14 100023149 missense probably damaging 1.00
IGL02746:Klf12 APN 14 99900220 missense probably benign 0.17
IGL02839:Klf12 APN 14 99900239 nonsense probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0212:Klf12 UTSW 14 100022862 missense probably benign
R0577:Klf12 UTSW 14 100023149 missense probably damaging 0.99
R1980:Klf12 UTSW 14 100149726 splice site probably null
R2017:Klf12 UTSW 14 100022637 missense possibly damaging 0.87
R2282:Klf12 UTSW 14 99900145 missense probably damaging 0.96
R2317:Klf12 UTSW 14 99942067 missense probably benign 0.00
R2901:Klf12 UTSW 14 99900146 missense probably damaging 0.98
R4946:Klf12 UTSW 14 100022957 missense possibly damaging 0.53
R5386:Klf12 UTSW 14 99900159 missense probably damaging 1.00
R5802:Klf12 UTSW 14 100022894 missense probably benign 0.33
R5903:Klf12 UTSW 14 100022688 missense probably damaging 0.99
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6753:Klf12 UTSW 14 100109776 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCATGCACTGATGAGCCC -3'
(R):5'- TAGCTTGTGAGGAACATCCGG -3'

Sequencing Primer
(F):5'- ATGCACTGATGAGCCCAGGAC -3'
(R):5'- CATGAGGTTACGGAATCCA -3'
Posted On2017-08-16