Incidental Mutation 'R6037:Lifr'
ID486650
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 043258-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7186943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 800 (T800A)
Ref Sequence ENSEMBL: ENSMUSP00000154750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: T800A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: T800A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: T800A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
Predicted Effect probably benign
Transcript: ENSMUST00000227727
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 unclassified probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0305:Lifr UTSW 15 7177501 missense probably damaging 0.99
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1906:Lifr UTSW 15 7188131 missense probably damaging 0.98
R2099:Lifr UTSW 15 7157251 missense probably benign
R2102:Lifr UTSW 15 7186923 missense probably damaging 1.00
R2136:Lifr UTSW 15 7181857 missense possibly damaging 0.89
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R4883:Lifr UTSW 15 7185625 missense possibly damaging 0.94
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
R7106:Lifr UTSW 15 7172924 missense probably benign 0.02
R7107:Lifr UTSW 15 7178940 missense possibly damaging 0.88
R7274:Lifr UTSW 15 7167059 critical splice donor site probably null
R7625:Lifr UTSW 15 7169242 missense probably damaging 0.99
R7631:Lifr UTSW 15 7184777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTGAATGTGGCCCCG -3'
(R):5'- CTTACAACAGTGGTCCGCAAC -3'

Sequencing Primer
(F):5'- ATGTGGCCCCGGAGCTTTG -3'
(R):5'- CCTGTATTAAAGGGGTGCATCAC -3'
Posted On2017-08-16