Incidental Mutation 'R6037:Ece2'
ID486652
Institutional Source Beutler Lab
Gene Symbol Ece2
Ensembl Gene ENSMUSG00000022842
Gene Nameendothelin converting enzyme 2
Synonyms1810009K13Rik, 9630025D12Rik, 6330509A19Rik
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6037 (G1)
Quality Score217.009
Status Not validated
Chromosome16
Chromosomal Location20629828-20646485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20630362 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 17 (Y17C)
Ref Sequence ENSEMBL: ENSMUSP00000114039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003898] [ENSMUST00000079600] [ENSMUST00000120394] [ENSMUST00000122306] [ENSMUST00000133344]
Predicted Effect probably damaging
Transcript: ENSMUST00000003898
AA Change: Y17C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003898
Gene: ENSMUSG00000022842
AA Change: Y17C

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 8.3e-125 PFAM
Pfam:Peptidase_M13 559 762 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079600
SMART Domains Protein: ENSMUSP00000078550
Gene: ENSMUSG00000115293

DomainStartEndE-ValueType
Pfam:Methyltransf_11 63 158 8.5e-8 PFAM
transmembrane domain 179 201 N/A INTRINSIC
Pfam:Peptidase_M13_N 233 618 1.2e-124 PFAM
Pfam:Peptidase_M13 677 880 1.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120394
AA Change: Y164C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113475
Gene: ENSMUSG00000115293
AA Change: Y164C

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 163 1.2e-8 PFAM
Pfam:Methyltransf_11 63 163 1.7e-9 PFAM
transmembrane domain 208 230 N/A INTRINSIC
Pfam:Peptidase_M13_N 262 647 5e-109 PFAM
Pfam:Peptidase_M13 706 909 9.4e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122306
AA Change: Y17C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114039
Gene: ENSMUSG00000022842
AA Change: Y17C

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Pfam:Peptidase_M13_N 115 500 6.9e-125 PFAM
Pfam:Peptidase_M13 559 709 6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125971
SMART Domains Protein: ENSMUSP00000120239
Gene: ENSMUSG00000022842

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 1 261 1.3e-71 PFAM
Pfam:Peptidase_M13 320 482 3.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133344
SMART Domains Protein: ENSMUSP00000119693
Gene: ENSMUSG00000022842

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:Peptidase_M13_N 86 471 7.5e-125 PFAM
Pfam:Peptidase_M13 530 733 1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152246
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family, which includes type 2 integral membrane metallopeptidases. The encoded enzyme is a membrane-bound zinc-dependent metalloprotease. The enzyme catalyzes the cleavage of big endothelin to produce the vasoconstrictor endothelin-1, and plays a role in the processing of several neuroendocrine peptides. It may also have methyltransferase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice develop normally, are viable and healthy, and exhibit normal fertility in both sexes, as well as a normal life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Mus81 T C 19: 5,484,004 K400E probably damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Ece2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Ece2 APN 16 20632794 missense possibly damaging 0.88
IGL01644:Ece2 APN 16 20617866 missense possibly damaging 0.93
IGL02414:Ece2 APN 16 20640706 missense probably damaging 1.00
IGL02754:Ece2 APN 16 20632648 missense probably damaging 1.00
IGL03368:Ece2 APN 16 20644158 missense possibly damaging 0.95
IGL03383:Ece2 APN 16 20633097 missense possibly damaging 0.90
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0063:Ece2 UTSW 16 20642317 missense probably benign
R0750:Ece2 UTSW 16 20633050 missense probably benign 0.00
R1304:Ece2 UTSW 16 20611782 missense probably damaging 1.00
R1500:Ece2 UTSW 16 20644242 missense probably damaging 1.00
R1539:Ece2 UTSW 16 20642513 missense probably damaging 1.00
R1667:Ece2 UTSW 16 20637838 missense possibly damaging 0.78
R1702:Ece2 UTSW 16 20631246 missense probably damaging 0.99
R1903:Ece2 UTSW 16 20645172 missense probably damaging 0.99
R1937:Ece2 UTSW 16 20617866 missense probably damaging 0.99
R2014:Ece2 UTSW 16 20642317 missense probably benign
R4393:Ece2 UTSW 16 20632848 missense probably damaging 1.00
R4678:Ece2 UTSW 16 20640718 missense probably damaging 1.00
R4839:Ece2 UTSW 16 20631168 missense probably damaging 1.00
R4857:Ece2 UTSW 16 20617806 missense probably damaging 1.00
R4871:Ece2 UTSW 16 20644155 missense probably damaging 1.00
R4903:Ece2 UTSW 16 20631222 nonsense probably null
R4914:Ece2 UTSW 16 20644070 missense probably damaging 1.00
R5119:Ece2 UTSW 16 20618631 missense probably damaging 0.98
R5218:Ece2 UTSW 16 20618540 missense probably benign 0.06
R5642:Ece2 UTSW 16 20643727 missense probably benign 0.42
R5911:Ece2 UTSW 16 20638760 missense probably damaging 1.00
R6037:Ece2 UTSW 16 20630362 missense probably damaging 1.00
R6253:Ece2 UTSW 16 20639182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGCAGTGACTGTGATG -3'
(R):5'- AAATGCCTCACTACAGTCCTGG -3'

Sequencing Primer
(F):5'- TGAGTGAACTGGCAGCGTC -3'
(R):5'- ACTACAGTCCTGGCGCAGAG -3'
Posted On2017-08-16