Incidental Mutation 'R6037:Mus81'
ID486655
Institutional Source Beutler Lab
Gene Symbol Mus81
Ensembl Gene ENSMUSG00000024906
Gene NameMUS81 structure-specific endonuclease subunit
Synonyms
MMRRC Submission 043258-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R6037 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5482345-5488402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5484004 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 400 (K400E)
Ref Sequence ENSEMBL: ENSMUSP00000114895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000167371] [ENSMUST00000167827] [ENSMUST00000168330]
PDB Structure
Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000025841
AA Change: K400E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906
AA Change: K400E

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070118
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124334
AA Change: K400E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906
AA Change: K400E

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect unknown
Transcript: ENSMUST00000133436
AA Change: K364E
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906
AA Change: K364E

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154215
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164388
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165485
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166253
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167371
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167827
SMART Domains Protein: ENSMUSP00000127478
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 9e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
EGF_CA 135 174 1.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous and heterozygous null mice for one allele display increased tumor incidence and reduced life spans. Homozygous null mice for a second allele display normal life span and tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abi2 C A 1: 60,464,579 P212T probably damaging Het
Ano4 A G 10: 89,317,246 F68S possibly damaging Het
Art5 C A 7: 102,098,384 A63S probably benign Het
Asgr1 T A 11: 70,056,421 S96R probably benign Het
Bdp1 A T 13: 100,027,449 V2248D possibly damaging Het
Cacna1s C T 1: 136,070,967 A200V possibly damaging Het
Cacna2d2 A G 9: 107,513,539 K357E probably damaging Het
Cfap52 C T 11: 67,946,300 G212R probably benign Het
Dcun1d3 A G 7: 119,857,742 F249S probably damaging Het
Ece2 A G 16: 20,630,362 Y17C probably damaging Het
Efemp1 C T 11: 28,921,760 T425I probably damaging Het
Eprs A G 1: 185,396,109 E562G probably damaging Het
Fbn2 T C 18: 58,044,223 T2001A probably benign Het
Flt4 G A 11: 49,637,040 R940H probably damaging Het
Fry T A 5: 150,428,179 M1716K probably benign Het
Gm10684 T A 9: 45,107,741 probably benign Het
Gm281 T C 14: 13,864,282 N348S probably damaging Het
Hivep1 G A 13: 42,157,940 V1219I probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Il23r C T 6: 67,478,954 V177M probably damaging Het
Klf12 T C 14: 99,900,214 S299G probably benign Het
Lama5 G A 2: 180,207,013 R265C probably damaging Het
Lifr A G 15: 7,186,943 T800A probably damaging Het
Megf8 T C 7: 25,364,406 L2729P probably damaging Het
Mki67 A C 7: 135,696,803 S2167R possibly damaging Het
Nomo1 T A 7: 46,062,999 I656N possibly damaging Het
Oas3 T C 5: 120,769,319 T418A probably benign Het
Olfr1034 T C 2: 86,046,584 M34T probably benign Het
Olfr1066 T A 2: 86,455,789 I161L probably benign Het
Olfr147 T A 9: 38,403,305 C144S probably benign Het
Olfr301 C T 7: 86,413,270 L303F probably benign Het
Olfr936 A G 9: 39,047,107 V104A probably damaging Het
Olr1 A G 6: 129,493,541 L221P probably damaging Het
Pih1d1 C T 7: 45,156,314 A69V probably damaging Het
Pkdrej A C 15: 85,819,766 S656R probably damaging Het
Polr3f A G 2: 144,536,023 D171G probably damaging Het
Rasal1 T C 5: 120,649,501 V11A possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Sptbn4 T A 7: 27,364,170 Y2277F probably damaging Het
St6galnac6 A G 2: 32,612,228 Q7R probably damaging Het
Thrsp T G 7: 97,417,292 D71A possibly damaging Het
Vmn2r1 C A 3: 64,081,729 Q30K probably benign Het
Wipf2 C T 11: 98,896,179 P345S probably benign Het
Zeb2 G T 2: 44,988,640 S1170* probably null Het
Zfp947 A G 17: 22,147,434 Y38H probably damaging Het
Other mutations in Mus81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Mus81 APN 19 5485633 unclassified probably benign
IGL03140:Mus81 APN 19 5483956 missense probably damaging 1.00
IGL03370:Mus81 APN 19 5484963 unclassified probably benign
city UTSW 19 5487793 missense probably benign 0.30
country UTSW 19 5484211 missense probably damaging 1.00
R0116:Mus81 UTSW 19 5486524 missense probably damaging 1.00
R0480:Mus81 UTSW 19 5487931 unclassified probably benign
R1243:Mus81 UTSW 19 5485117 missense probably benign
R1439:Mus81 UTSW 19 5485117 missense probably benign
R1477:Mus81 UTSW 19 5486334 missense probably benign 0.00
R1795:Mus81 UTSW 19 5483476 missense probably benign 0.00
R2346:Mus81 UTSW 19 5484963 unclassified probably benign
R2863:Mus81 UTSW 19 5486500 missense probably damaging 1.00
R3785:Mus81 UTSW 19 5485361 unclassified probably benign
R5312:Mus81 UTSW 19 5483494 missense possibly damaging 0.79
R5489:Mus81 UTSW 19 5487889 unclassified probably benign
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6970:Mus81 UTSW 19 5485526 missense probably benign 0.45
R7037:Mus81 UTSW 19 5486080 missense probably damaging 1.00
R7060:Mus81 UTSW 19 5487793 missense probably benign 0.30
R7100:Mus81 UTSW 19 5484211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTGAAGACTAAGCCC -3'
(R):5'- ACTTAGTGGAAGAACATGGGTC -3'

Sequencing Primer
(F):5'- TTTCCCAGGCCTCAGTAGG -3'
(R):5'- ACATGGGTCTGTCCACAACCTTAG -3'
Posted On2017-08-16