Incidental Mutation 'R6038:Wdhd1'
ID486704
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47263580 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 455 (Q455R)
Ref Sequence ENSEMBL: ENSMUSP00000107420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111790
AA Change: Q455R

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: Q455R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 2.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111791
AA Change: Q455R

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: Q455R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111792
AA Change: Q418R

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: Q418R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187531
AA Change: Q455R

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: Q455R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228742
Meta Mutation Damage Score 0.1039 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Olfr741 T C 14: 50,486,220 L254P probably damaging Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3731:Wdhd1 UTSW 14 47247892 missense possibly damaging 0.89
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R4994:Wdhd1 UTSW 14 47268654 critical splice donor site probably null
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6156:Wdhd1 UTSW 14 47268196 missense probably damaging 0.99
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6298:Wdhd1 UTSW 14 47273122 missense possibly damaging 0.67
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTGGTGTTTACAGCCAATTCTAGTTTC -3'
(R):5'- CACTATTACCACAGCTTTCTGAAG -3'

Sequencing Primer
(F):5'- TGCTCTAATAGTTCAACAATGCCAG -3'
(R):5'- AGTTATAGTGCGTGAGTCTG -3'
Posted On2017-08-16