Incidental Mutation 'R6038:Olfr741'
ID486705
Institutional Source Beutler Lab
Gene Symbol Olfr741
Ensembl Gene ENSMUSG00000095765
Gene Nameolfactory receptor 741
SynonymsMOR106-15, MOR106-10, GA_x6K02T2PMLR-6197851-6198786
MMRRC Submission 044208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6038 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50472738-50488338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50486220 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 254 (L254P)
Ref Sequence ENSEMBL: ENSMUSP00000151020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071932] [ENSMUST00000205518] [ENSMUST00000213903]
Predicted Effect probably damaging
Transcript: ENSMUST00000071932
AA Change: L254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071824
Gene: ENSMUSG00000095765
AA Change: L254P

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.2e-55 PFAM
Pfam:7tm_1 45 294 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205518
AA Change: L254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213903
AA Change: L254P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,304,360 C1327R probably damaging Het
Adcy7 A G 8: 88,322,980 T704A probably benign Het
Adgra3 A T 5: 49,999,145 Y414* probably null Het
Adgrf1 T C 17: 43,295,209 S75P probably benign Het
Akirin1 A G 4: 123,750,163 M1T probably null Het
Antxr1 C A 6: 87,287,000 probably null Het
Arid1b A T 17: 5,336,682 Y1470F probably benign Het
Baiap3 T C 17: 25,246,334 D649G probably damaging Het
BC067074 G A 13: 113,318,619 V400M possibly damaging Het
Cabin1 A G 10: 75,739,366 V615A probably benign Het
Cntnap1 G A 11: 101,184,636 R880Q probably benign Het
Col28a1 T C 6: 8,013,140 T971A probably benign Het
Coro7 A T 16: 4,679,550 probably null Het
Defb19 T G 2: 152,576,267 probably null Het
Dnah17 T C 11: 118,055,889 D3045G probably benign Het
Dock4 A T 12: 40,733,351 probably null Het
Egln3 A G 12: 54,181,690 V210A probably damaging Het
Epb41l4a T C 18: 33,854,335 S330G probably benign Het
Epha7 G A 4: 28,821,521 E229K probably damaging Het
Fam71a C T 1: 191,162,722 E575K probably damaging Het
Fam71e1 C T 7: 44,500,295 R147W probably damaging Het
Fam71e2 T C 7: 4,753,595 probably null Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Gm29587 G A 12: 74,222,535 probably null Het
Gxylt2 T A 6: 100,804,594 L410Q probably damaging Het
H2-M10.3 C A 17: 36,368,395 C6F probably benign Het
Hecw1 G T 13: 14,346,062 Q197K probably benign Het
Hk3 T C 13: 55,006,560 M778V probably benign Het
Hydin A G 8: 110,599,031 T4691A probably benign Het
Larp1 A G 11: 58,041,605 E204G possibly damaging Het
Lrp12 A C 15: 39,872,380 W738G probably damaging Het
Mdga2 A T 12: 66,630,053 D488E probably damaging Het
Mrc1 G C 2: 14,257,071 W290C probably damaging Het
Nhp2 T C 11: 51,620,085 V55A probably benign Het
Nrm T C 17: 35,861,505 S41P possibly damaging Het
Olfr1116 T A 2: 87,269,267 I141N possibly damaging Het
Olfr58 A G 9: 19,783,562 Y143C probably benign Het
Osbpl7 C T 11: 97,050,716 P22S probably benign Het
Pebp1 A T 5: 117,284,105 L124Q probably benign Het
Pfkp G T 13: 6,597,969 H524N probably benign Het
Pnmt G A 11: 98,387,768 D187N probably damaging Het
Ppl A T 16: 5,102,581 I355K possibly damaging Het
Prom1 A T 5: 44,001,793 Y836N probably damaging Het
Rubcnl T C 14: 75,031,970 S23P probably benign Het
Sap130 T A 18: 31,680,486 I532N probably damaging Het
Serpina1e A T 12: 103,946,836 probably null Het
Skiv2l2 A T 13: 112,891,290 S679T probably benign Het
Slc12a3 T G 8: 94,330,472 S124R probably benign Het
Slc24a5 A G 2: 125,085,731 T317A probably benign Het
Smarcad1 T C 6: 65,073,248 S284P possibly damaging Het
Spag9 C G 11: 94,112,092 R724G probably damaging Het
Speg T C 1: 75,418,459 probably null Het
Steap3 A G 1: 120,241,641 Y271H probably damaging Het
Syne2 C T 12: 75,878,384 Q44* probably null Het
Tas2r114 A T 6: 131,689,481 C195S possibly damaging Het
Tcl1b4 T C 12: 105,202,507 M10T possibly damaging Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Vmn2r60 C A 7: 42,194,962 A583D probably benign Het
Wdhd1 T C 14: 47,263,580 Q455R possibly damaging Het
Wdr17 A G 8: 54,632,311 probably null Het
Xbp1 T C 11: 5,524,798 L233P probably benign Het
Zbtb17 A G 4: 141,464,441 E288G probably benign Het
Other mutations in Olfr741
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Olfr741 APN 14 50485773 missense probably damaging 0.98
IGL01796:Olfr741 APN 14 50485541 missense probably benign 0.28
IGL01916:Olfr741 APN 14 50485493 missense probably benign 0.01
IGL02686:Olfr741 APN 14 50485969 missense probably benign 0.01
IGL02874:Olfr741 APN 14 50486229 missense possibly damaging 0.57
IGL02898:Olfr741 APN 14 50486186 missense probably damaging 1.00
PIT4515001:Olfr741 UTSW 14 50486079 missense probably benign 0.03
R0085:Olfr741 UTSW 14 50486334 missense probably benign 0.16
R1777:Olfr741 UTSW 14 50486300 missense probably benign 0.08
R1850:Olfr741 UTSW 14 50485598 missense probably benign
R2270:Olfr741 UTSW 14 50486037 missense probably damaging 1.00
R2338:Olfr741 UTSW 14 50485640 missense possibly damaging 0.47
R2971:Olfr741 UTSW 14 50485608 missense probably damaging 0.99
R4594:Olfr741 UTSW 14 50486162 missense probably benign 0.00
R5383:Olfr741 UTSW 14 50486052 nonsense probably null
R5708:Olfr741 UTSW 14 50485995 missense probably damaging 1.00
R6038:Olfr741 UTSW 14 50486220 missense probably damaging 1.00
R7116:Olfr741 UTSW 14 50485568 missense probably benign 0.00
R7702:Olfr741 UTSW 14 50486294 missense possibly damaging 0.79
R8169:Olfr741 UTSW 14 50486235 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TATAGACCACTTCCTGTGTGACCC -3'
(R):5'- ATGTTCTCAAAATCTTCTGTAGGGC -3'

Sequencing Primer
(F):5'- CTGTTCCAGAGTCCCATTGATAGAG -3'
(R):5'- CAAAATCTTCTGTAGGGCATTTTTC -3'
Posted On2017-08-16