Incidental Mutation 'R6039:Klhl32'
ID486729
Institutional Source Beutler Lab
Gene Symbol Klhl32
Ensembl Gene ENSMUSG00000040387
Gene Namekelch-like 32
SynonymsLOC384000, D4Ertd389e, 6430524H05Rik
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location24612554-24851124 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 24792615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652]
Predicted Effect probably null
Transcript: ENSMUST00000084781
SMART Domains Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 138 1.28e-22 SMART
BACK 111 212 3.17e-22 SMART
Kelch 257 313 4.07e-1 SMART
Kelch 314 365 3.57e-1 SMART
Kelch 366 413 3.77e-4 SMART
Kelch 414 461 7.04e-4 SMART
Kelch 462 514 6.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108213
Predicted Effect probably null
Transcript: ENSMUST00000108214
SMART Domains Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 225 3.31e-2 SMART
Blast:Kelch 233 285 1e-31 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000108218
SMART Domains Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 245 3.17e-22 SMART
Kelch 290 346 4.07e-1 SMART
Kelch 347 398 3.57e-1 SMART
Kelch 399 446 3.77e-4 SMART
Kelch 447 494 7.04e-4 SMART
Kelch 495 547 6.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140652
SMART Domains Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142373
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nek9 G A 12: 85,313,085 A531V probably benign Het
Nlrp12 A T 7: 3,241,372 I170N possibly damaging Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pde4d A T 13: 109,948,342 Q422L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Psg28 T C 7: 18,426,182 D363G possibly damaging Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc38a9 A T 13: 112,669,697 I26F probably damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Klhl32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Klhl32 APN 4 24682245 missense probably damaging 1.00
IGL02293:Klhl32 APN 4 24626935 missense probably damaging 1.00
IGL02374:Klhl32 APN 4 24743856 critical splice donor site probably null
IGL02824:Klhl32 APN 4 24682237 nonsense probably null
IGL03211:Klhl32 APN 4 24792616 critical splice donor site probably null
IGL03374:Klhl32 APN 4 24649533 intron probably benign
R0071:Klhl32 UTSW 4 24743907 missense probably damaging 0.98
R0478:Klhl32 UTSW 4 24792777 missense probably damaging 1.00
R0856:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R0908:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R1882:Klhl32 UTSW 4 24743916 nonsense probably null
R1927:Klhl32 UTSW 4 24617474 missense probably benign 0.00
R2137:Klhl32 UTSW 4 24629275 nonsense probably null
R3176:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R3276:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R4059:Klhl32 UTSW 4 24792781 missense probably damaging 1.00
R4246:Klhl32 UTSW 4 24800822 missense possibly damaging 0.50
R4597:Klhl32 UTSW 4 24629339 missense probably benign 0.21
R4801:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4802:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4929:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R5654:Klhl32 UTSW 4 24800805 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6362:Klhl32 UTSW 4 24629195 missense probably null 1.00
R6490:Klhl32 UTSW 4 24711578 intron probably benign
R6948:Klhl32 UTSW 4 24629250 missense probably benign 0.00
R6981:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTCAGATGCAACGGTCTGC -3'
(R):5'- GTATTCAAGAAATGCTGACGGGC -3'

Sequencing Primer
(F):5'- GATGCAACGGTCTGCTTCTCATTG -3'
(R):5'- ATGCTGACGGGCCAGAG -3'
Posted On2017-08-16