Mutagenetix > Incidental Mutations

Incidental Mutation 'R0523:Trp53bp1'

48674

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

038716-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121193281-121271407 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 121251868 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 317 (A317S)

Ref Sequence

ENSEMBL: ENSMUSP00000114457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000129752] [ENSMUST00000131245]

Predicted Effect

probably null
Transcript: ENSMUST00000110647
AA Change: A317S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: A317S

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110648
AA Change: A317S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: A317S

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129752
AA Change: G54C

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably null
Transcript: ENSMUST00000131245
AA Change: A317S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: A317S

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136617

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,644,629	M1K	probably null	Het
2410089E03Rik	T	A	15: 8,194,386	Y878N	probably damaging	Het
A2ml1	T	C	6: 128,558,326	D807G	possibly damaging	Het
Actl9	T	A	17: 33,433,349	W128R	probably damaging	Het
Aggf1	T	C	13: 95,356,416	I562V	probably damaging	Het
Ano3	T	A	2: 110,884,855	E79D	probably benign	Het
Apobec1	T	A	6: 122,581,545	I84F	probably damaging	Het
Atp6v1b2	T	C	8: 69,109,985	F458L	possibly damaging	Het
BC051142	G	T	17: 34,445,499		probably null	Het
Bco2	A	T	9: 50,534,626	V490E	probably damaging	Het
Catsperg1	G	A	7: 29,185,190		probably benign	Het
Cdc37	T	C	9: 21,142,996	K111R	probably damaging	Het
Cfap54	T	C	10: 92,908,883		probably benign	Het
Cpox	T	A	16: 58,675,245	C308*	probably null	Het
Ctnna3	T	G	10: 64,675,909	M626R	probably damaging	Het
Cyp2c68	T	C	19: 39,739,429	E93G	probably benign	Het
Cyp2s1	G	A	7: 25,806,050	R330W	probably damaging	Het
Diaph1	C	T	18: 37,856,500	V860I	possibly damaging	Het
Dicer1	A	G	12: 104,702,491	S1311P	probably damaging	Het
Dpyd	G	A	3: 118,899,203	R332K	probably benign	Het
E130308A19Rik	G	A	4: 59,719,716	R416H	probably damaging	Het
Eef1d	T	C	15: 75,903,156	D218G	probably benign	Het
Eif2ak1	T	C	5: 143,882,166	V215A	probably damaging	Het
Eif2ak4	T	C	2: 118,442,096		probably null	Het
Fam71e2	A	G	7: 4,759,393	S246P	possibly damaging	Het
Fcrl5	T	C	3: 87,457,792	S583P	possibly damaging	Het
Grid2ip	C	A	5: 143,373,043	Q29K	possibly damaging	Het
Htr1f	A	T	16: 64,925,899	N343K	probably damaging	Het
Hvcn1	T	C	5: 122,216,365		probably null	Het
Igf2r	T	C	17: 12,692,064	I1956V	probably benign	Het
Impdh2	A	T	9: 108,561,819		probably null	Het
Impdh2	C	T	9: 108,561,820	T96I	possibly damaging	Het
Lactb	C	G	9: 66,970,692	G285A	probably benign	Het
Lrrc43	T	C	5: 123,501,242	S445P	probably damaging	Het
Maats1	G	A	16: 38,328,374	P231S	probably damaging	Het
Mapk12	T	G	15: 89,135,645	M120L	probably benign	Het
Mroh8	C	G	2: 157,224,036	A669P	probably damaging	Het
Mrpl38	A	C	11: 116,132,018	H373Q	probably benign	Het
Myocd	A	G	11: 65,180,902	V740A	probably damaging	Het
Naprt	A	G	15: 75,892,465	F300S	probably damaging	Het
Ncam2	T	C	16: 81,461,643	I271T	probably damaging	Het
Nek4	A	G	14: 30,980,038	T582A	probably benign	Het
Notch2	C	T	3: 98,070,970	T89I	probably benign	Het
Notch2	G	A	3: 98,111,598	R692H	probably benign	Het
Nt5c3	A	T	6: 56,883,681	N296K	probably damaging	Het
Nt5c3b	T	A	11: 100,436,210	I87F	probably damaging	Het
Oas3	T	C	5: 120,766,144	Q555R	unknown	Het
Olfr1013	T	A	2: 85,769,929	S43T	probably benign	Het
Olfr494	A	T	7: 108,368,231	H247L	probably damaging	Het
Olfr699	A	G	7: 106,790,326	V225A	probably damaging	Het
P3h1	C	A	4: 119,241,530	Q410K	probably benign	Het
Pax3	A	G	1: 78,195,441	V44A	possibly damaging	Het
Pde1c	T	A	6: 56,174,941	L252F	probably damaging	Het
Pdzd7	T	A	19: 45,036,090	T497S	probably benign	Het
Piezo2	T	C	18: 63,022,481	T253A	probably damaging	Het
Pipox	T	C	11: 77,892,139	E79G	probably damaging	Het
Pole	G	T	5: 110,303,593	M829I	probably damaging	Het
Ppp1r12c	A	T	7: 4,489,772	L156Q	probably damaging	Het
Psme2b	T	G	11: 48,945,782	T113P	probably damaging	Het
Ptprq	A	G	10: 107,580,220	I1739T	possibly damaging	Het
Qser1	T	C	2: 104,789,676	T174A	probably damaging	Het
Rcor3	T	G	1: 192,130,436	D81A	probably damaging	Het
Rev3l	T	C	10: 39,848,049	V785A	probably benign	Het
Rnf11	T	C	4: 109,456,922	D90G	probably benign	Het
Sh3tc1	GCCTCCTCCTCCTCCTCC	GCCTCCTCCTCCTCC	5: 35,724,066		probably benign	Het
Smad2	T	A	18: 76,262,552	S21T	probably benign	Het
Smc4	A	G	3: 69,025,888	D639G	probably damaging	Het
Smtn	A	T	11: 3,524,664	S716T	possibly damaging	Het
Smug1	G	T	15: 103,155,709	Q262K	probably benign	Het
Sspo	G	T	6: 48,451,860	G403V	probably benign	Het
Tas2r131	A	G	6: 132,957,451	F132L	possibly damaging	Het
Tgm3	T	C	2: 130,044,662		probably null	Het
Tigd2	C	T	6: 59,210,373	T75M	probably benign	Het
Tnfrsf13b	T	C	11: 61,147,587	V232A	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim47	A	G	11: 116,107,890	L301S	probably damaging	Het
Trim75	G	A	8: 64,983,790	H3Y	probably benign	Het
Ttc29	G	C	8: 78,276,837	L227F	probably benign	Het
Ttc39d	G	A	17: 80,216,457	D182N	possibly damaging	Het
Ttll10	T	A	4: 156,045,361	R164*	probably null	Het
Ufsp2	T	A	8: 45,996,743	D447E	probably benign	Het
Ugt2b37	T	A	5: 87,251,832	L272F	possibly damaging	Het
Vps13b	T	C	15: 35,472,050	V833A	probably benign	Het
Zbbx	T	C	3: 75,081,858	T308A	probably benign	Het
Zfp933	G	A	4: 147,826,462	Q226*	probably null	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121256579	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121235995	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121208482	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121270319	splice site	probably null
IGL01639:Trp53bp1	APN	2	121202692	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121236025	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121211304	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121215896	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121236589	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121199074	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121202710	missense	possibly damaging	0.67
chives	UTSW	2	121251868	missense	probably null	0.13
concur	UTSW	2	121270319	splice site	probably null
confirmation	UTSW	2	121205113	critical splice acceptor site	probably null
Infra	UTSW	2	121247499	critical splice donor site	probably null
Legume	UTSW	2	121199042	missense	probably damaging	0.99
lentil	UTSW	2	121251868	missense	probably null	0.13
lentil2	UTSW	2	121207887	missense	probably damaging	1.00
Profundus	UTSW	2	121207803	missense	probably damaging	1.00
split_pea	UTSW	2	121228606	nonsense	probably null
verily	UTSW	2	121211313	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121271275	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121204497	missense	probably benign
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121270237	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121204943	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121236017	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121269969	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121227801	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121228172	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121270528	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121235707	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121248264	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121204318	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121270642	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121236184	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121252000	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121205036	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121204483	missense	probably benign
R2143:Trp53bp1	UTSW	2	121216064	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121270273	nonsense	probably null
R2296:Trp53bp1	UTSW	2	121209247	missense	possibly damaging	0.96
R3106:Trp53bp1	UTSW	2	121236652	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121228626	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121205085	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121256650	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121207951	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121207887	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121211313	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121227809	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121207879	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121228606	nonsense	probably null
R4850:Trp53bp1	UTSW	2	121205113	critical splice acceptor site	probably null
R4870:Trp53bp1	UTSW	2	121256641	missense	probably damaging	1.00
R4879:Trp53bp1	UTSW	2	121202603	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121221220	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121270546	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121270319	splice site	probably null
R5111:Trp53bp1	UTSW	2	121211387	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121216117	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121243983	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121207746	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121236662	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121243914	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121208392	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121205021	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121236823	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121256602	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121269945	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121270612	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121228603	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121247499	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121207803	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121270576	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121209309	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121228666	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121199113	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121208040	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121199035	missense	probably damaging	1.00
R7339:Trp53bp1	UTSW	2	121236469	missense	probably benign	0.00
R7357:Trp53bp1	UTSW	2	121211300	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121236346	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121236638	missense	possibly damaging	0.65
R7643:Trp53bp1	UTSW	2	121247814	splice site	probably null
R7728:Trp53bp1	UTSW	2	121207899	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121205061	missense	probably damaging	0.99
R7955:Trp53bp1	UTSW	2	121235744	missense	possibly damaging	0.59
R8099:Trp53bp1	UTSW	2	121199749	missense	probably damaging	1.00
R8200:Trp53bp1	UTSW	2	121236176	missense	probably benign	0.00
R8282:Trp53bp1	UTSW	2	121199042	missense	probably damaging	0.99
RF046:Trp53bp1	UTSW	2	121216001	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121253645	missense	probably benign	0.04
Z1177:Trp53bp1	UTSW	2	121244060	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GGCACGAGACAGAAGAAGAAATG -3'
(R):5'- GTTGATCCGAATCTCCTAGGTCC -3'

Sequencing Primer
(F):5'- TGGCAACTCTGTCCGTAATC -3'
(R):5'- CCGTCCAGTCCTCAAGTTTC -3'

Posted On

2013-06-12