Incidental Mutation 'R6039:Nlrp12'
ID486740
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3241372 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 170 (I170N)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108653
AA Change: I170N

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: I170N

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205233
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Klhl32 A G 4: 24,792,615 probably null Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nek9 G A 12: 85,313,085 A531V probably benign Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pde4d A T 13: 109,948,342 Q422L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Psg28 T C 7: 18,426,182 D363G possibly damaging Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc38a9 A T 13: 112,669,697 I26F probably damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAAACCGGCCTTGGAAG -3'
(R):5'- CTAATGGCTATGTCACTGATCTTTC -3'

Sequencing Primer
(F):5'- AACATCACTTTGTGGGCCAG -3'
(R):5'- TCTTTCTACTAGATCTACAGACAACC -3'
Posted On2017-08-16