Incidental Mutation 'R6039:Pde4d'
ID486756
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109948342 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 422 (Q422L)
Ref Sequence ENSEMBL: ENSMUSP00000073742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably damaging
Transcript: ENSMUST00000074103
AA Change: Q422L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: Q422L

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079975
AA Change: Q442L

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: Q442L

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117420
AA Change: Q261L

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: Q261L

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117879
AA Change: Q248L

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: Q248L

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119507
AA Change: Q447L

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: Q447L

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect possibly damaging
Transcript: ENSMUST00000120664
AA Change: Q328L

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: Q328L

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120671
AA Change: Q547L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: Q547L

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122041
AA Change: Q491L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: Q491L

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135275
AA Change: Q444L

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: Q444L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: Q497L
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: Q497L

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155459
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177907
AA Change: Q491L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: Q491L

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Klhl32 A G 4: 24,792,615 probably null Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nek9 G A 12: 85,313,085 A531V probably benign Het
Nlrp12 A T 7: 3,241,372 I170N possibly damaging Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Psg28 T C 7: 18,426,182 D363G possibly damaging Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc38a9 A T 13: 112,669,697 I26F probably damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAGCATCCTAGAACTTGGGG -3'
(R):5'- GCCTTAAATCCCAACTGCTACG -3'

Sequencing Primer
(F):5'- CATGTATGTTGACCCAGATCAGC -3'
(R):5'- GAACCTGAGGTCATCTCT -3'
Posted On2017-08-16