Incidental Mutation 'R6039:Slc38a9'
ID486757
Institutional Source Beutler Lab
Gene Symbol Slc38a9
Ensembl Gene ENSMUSG00000047789
Gene Namesolute carrier family 38, member 9
Synonyms
MMRRC Submission 043259-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6039 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location112660751-112738749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112669697 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 26 (I26F)
Ref Sequence ENSEMBL: ENSMUSP00000152914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052514] [ENSMUST00000223581]
Predicted Effect probably damaging
Transcript: ENSMUST00000052514
AA Change: I26F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052172
Gene: ENSMUSG00000047789
AA Change: I26F

DomainStartEndE-ValueType
Pfam:Aa_trans 114 253 4.5e-17 PFAM
Pfam:Aa_trans 266 560 2.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223581
AA Change: I26F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224703
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,908,546 R416Q possibly damaging Het
Adgre1 C A 17: 57,406,859 D181E probably benign Het
Arhgap24 T C 5: 102,880,786 S183P probably damaging Het
Asb1 T C 1: 91,547,026 L90P probably damaging Het
Bmp3 T C 5: 98,872,350 F211L probably benign Het
C8a A G 4: 104,845,942 I306T probably benign Het
Cdkn3 G A 14: 46,769,916 G177R probably damaging Het
Chat A G 14: 32,449,027 S172P probably damaging Het
Chd5 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA 4: 152,353,621 probably benign Het
Cyp4a12a T C 4: 115,327,223 I265T probably damaging Het
Dlst T A 12: 85,118,890 probably null Het
Dnmt1 A T 9: 20,926,420 probably benign Het
Fbn1 C T 2: 125,363,880 E1066K probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fstl1 T A 16: 37,821,176 S105T probably benign Het
Gm19410 C G 8: 35,809,364 A1725G probably benign Het
Hspb7 A G 4: 141,423,904 N119S probably damaging Het
Il20 T A 1: 130,910,741 D73V possibly damaging Het
Insrr T C 3: 87,809,301 I612T possibly damaging Het
Kcnma1 T C 14: 23,309,037 Y1107C probably benign Het
Klhl32 A G 4: 24,792,615 probably null Het
Krt77 C A 15: 101,860,916 R470L possibly damaging Het
Muc1 T C 3: 89,232,029 Y579H probably damaging Het
Myof T C 19: 37,977,684 D396G probably damaging Het
Myom1 T G 17: 71,110,751 D1316E probably damaging Het
Nbea T C 3: 56,005,117 E1083G probably benign Het
Nek9 G A 12: 85,313,085 A531V probably benign Het
Nlrp12 A T 7: 3,241,372 I170N possibly damaging Het
Nup98 A G 7: 102,134,795 I1093T probably benign Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Paqr4 T C 17: 23,739,994 D11G probably damaging Het
Parp8 A G 13: 116,877,598 S561P probably damaging Het
Pcgf5 T A 19: 36,442,906 F179L probably damaging Het
Pde4d A T 13: 109,948,342 Q422L probably damaging Het
Pigs T A 11: 78,341,825 V495E probably damaging Het
Polh C T 17: 46,188,033 R252H probably benign Het
Psg28 T C 7: 18,426,182 D363G possibly damaging Het
Ptgir A T 7: 16,906,890 I36F possibly damaging Het
Ptprr G A 10: 116,236,763 probably null Het
Rax C T 18: 65,935,347 G229D unknown Het
Secisbp2l T A 2: 125,773,216 H163L probably benign Het
Sf3a2 A G 10: 80,801,463 Y45C probably damaging Het
Sgo2a C T 1: 58,016,616 T653I possibly damaging Het
Slc5a8 A G 10: 88,886,574 I90V probably benign Het
Slx4 G A 16: 3,986,047 H968Y possibly damaging Het
Stam2 T C 2: 52,709,599 T233A probably benign Het
Tln1 G C 4: 43,555,052 F259L probably damaging Het
Trav4-2 G A 14: 53,418,409 V8M possibly damaging Het
Ttll5 T A 12: 85,831,955 H45Q probably damaging Het
Ttn C T 2: 76,884,418 probably benign Het
Ush2a T A 1: 188,319,020 F234L possibly damaging Het
Vmn2r74 T A 7: 85,958,318 probably null Het
Wdr6 CTG C 9: 108,573,795 probably null Het
Zfp644 A G 5: 106,635,425 S997P possibly damaging Het
Zfp853 G A 5: 143,288,774 Q364* probably null Het
Other mutations in Slc38a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Slc38a9 APN 13 112701618 missense probably damaging 1.00
IGL01950:Slc38a9 APN 13 112695253 missense probably damaging 1.00
IGL01955:Slc38a9 APN 13 112695418 splice site probably benign
IGL02352:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02359:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02407:Slc38a9 APN 13 112690243 missense probably benign
IGL02511:Slc38a9 APN 13 112698007 missense possibly damaging 0.47
IGL02588:Slc38a9 APN 13 112697977 splice site probably null
IGL03278:Slc38a9 APN 13 112689518 splice site probably benign
R0126:Slc38a9 UTSW 13 112729257 missense possibly damaging 0.52
R0553:Slc38a9 UTSW 13 112714198 missense probably damaging 1.00
R0558:Slc38a9 UTSW 13 112729196 critical splice acceptor site probably null
R0699:Slc38a9 UTSW 13 112723289 missense probably damaging 1.00
R1036:Slc38a9 UTSW 13 112701659 splice site probably benign
R1142:Slc38a9 UTSW 13 112714210 missense probably damaging 1.00
R1344:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R1418:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R4223:Slc38a9 UTSW 13 112714248 critical splice donor site probably null
R4344:Slc38a9 UTSW 13 112729215 missense probably benign 0.02
R4824:Slc38a9 UTSW 13 112723298 missense probably damaging 0.98
R4872:Slc38a9 UTSW 13 112689564 missense probably damaging 1.00
R5841:Slc38a9 UTSW 13 112695322 missense possibly damaging 0.76
R5844:Slc38a9 UTSW 13 112731501 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6151:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
R6166:Slc38a9 UTSW 13 112695267 missense possibly damaging 0.96
R6175:Slc38a9 UTSW 13 112703559 nonsense probably null
R6324:Slc38a9 UTSW 13 112726100 missense probably benign 0.01
R6747:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R6920:Slc38a9 UTSW 13 112701526 missense possibly damaging 0.63
R7342:Slc38a9 UTSW 13 112669591 start gained probably benign
R7592:Slc38a9 UTSW 13 112695355 missense probably damaging 0.99
R7787:Slc38a9 UTSW 13 112689346 missense probably damaging 0.99
R7860:Slc38a9 UTSW 13 112731614 missense probably benign
R7943:Slc38a9 UTSW 13 112731614 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCTTGCCTAAGAGTCGG -3'
(R):5'- ACACACATCAGGGTATGAGTC -3'

Sequencing Primer
(F):5'- TAGGGAGCCGCCTTTAAAAAC -3'
(R):5'- CAGGGTATGAGTCCTGTAAGAAAATG -3'
Posted On2017-08-16