Incidental Mutation 'R0523:Tgm3'
ID48676
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0523 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 130044662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably null
Transcript: ENSMUST00000110299
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCTTACATGCTTGCATCCTGGAAC -3'
(R):5'- AAGTGTGACCAGATCCAAAAGGCTC -3'

Sequencing Primer
(F):5'- TGCACAAAACCTGAGTGCTG -3'
(R):5'- AGTGGGACTCTTGGAACTCT -3'
Posted On2013-06-12