Incidental Mutation 'R5234:Adamtsl4'
ID486775
Institutional Source Beutler Lab
Gene Symbol Adamtsl4
Ensembl Gene ENSMUSG00000015850
Gene NameADAMTS-like 4
SynonymsTsrc1
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95676201-95687917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95680920 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 586 (M586V)
Ref Sequence ENSEMBL: ENSMUSP00000113424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015994] [ENSMUST00000117782] [ENSMUST00000148854]
Predicted Effect probably benign
Transcript: ENSMUST00000015994
AA Change: M586V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000015994
Gene: ENSMUSG00000015850
AA Change: M586V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3.9e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 995 1025 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117782
AA Change: M586V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113424
Gene: ENSMUSG00000015850
AA Change: M586V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 994 1026 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124410
Predicted Effect probably benign
Transcript: ENSMUST00000148854
SMART Domains Protein: ENSMUSP00000120844
Gene: ENSMUSG00000015850

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:TSP1 51 70 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151054
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ADAMTS superfamily of secreted proteins, which contain a metalloprotease domain at the N-terminus and a C-terminal ancillary domain. ADAMTS-like proteins lack protease activity and resemble the ancillary domain of ADAMTS proteins. ADAMTS-like proteins have been implicated in regulation of the extracellular matrix. The encoded protein contains 7 thrombospondin type 1 repeats, a conserved extracellular domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Atp1a4 A T 1: 172,227,170 I964K possibly damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Adamtsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl4 APN 3 95677533 missense probably benign 0.22
IGL01685:Adamtsl4 APN 3 95684595 missense possibly damaging 0.93
IGL01707:Adamtsl4 APN 3 95683991 missense probably benign 0.39
IGL02105:Adamtsl4 APN 3 95680064 missense probably damaging 1.00
IGL02545:Adamtsl4 APN 3 95683374 nonsense probably null
IGL03089:Adamtsl4 APN 3 95677246 missense probably damaging 1.00
R0099:Adamtsl4 UTSW 3 95684139 missense probably benign 0.00
R0718:Adamtsl4 UTSW 3 95679608 missense possibly damaging 0.49
R0962:Adamtsl4 UTSW 3 95684488 nonsense probably null
R1157:Adamtsl4 UTSW 3 95683661 missense possibly damaging 0.88
R1434:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R1486:Adamtsl4 UTSW 3 95681856 missense probably benign 0.23
R1579:Adamtsl4 UTSW 3 95685497 start gained probably benign
R1703:Adamtsl4 UTSW 3 95677614 missense probably damaging 1.00
R1757:Adamtsl4 UTSW 3 95677942 missense probably benign 0.00
R2018:Adamtsl4 UTSW 3 95681102 missense probably damaging 1.00
R2108:Adamtsl4 UTSW 3 95681047 missense probably damaging 1.00
R3889:Adamtsl4 UTSW 3 95680857 missense probably damaging 1.00
R4062:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4063:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4124:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4128:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4432:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4433:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4643:Adamtsl4 UTSW 3 95684619 missense possibly damaging 0.90
R4694:Adamtsl4 UTSW 3 95679745 missense probably damaging 1.00
R4719:Adamtsl4 UTSW 3 95679586 critical splice donor site probably null
R4929:Adamtsl4 UTSW 3 95678005 missense probably damaging 1.00
R5044:Adamtsl4 UTSW 3 95681650 critical splice donor site probably null
R5212:Adamtsl4 UTSW 3 95677670 missense probably damaging 1.00
R5268:Adamtsl4 UTSW 3 95680163 missense probably damaging 0.98
R5473:Adamtsl4 UTSW 3 95679993 missense probably damaging 0.98
R5509:Adamtsl4 UTSW 3 95681357 missense probably benign 0.00
R5566:Adamtsl4 UTSW 3 95685455 critical splice donor site probably null
R5891:Adamtsl4 UTSW 3 95682313 missense possibly damaging 0.95
R5906:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R6224:Adamtsl4 UTSW 3 95681729 missense probably damaging 1.00
R6530:Adamtsl4 UTSW 3 95681054 missense probably benign 0.00
R6861:Adamtsl4 UTSW 3 95680884 missense probably damaging 1.00
R7199:Adamtsl4 UTSW 3 95680809 missense probably benign 0.00
R8083:Adamtsl4 UTSW 3 95684401 missense possibly damaging 0.76
R8251:Adamtsl4 UTSW 3 95684574 missense probably damaging 1.00
X0028:Adamtsl4 UTSW 3 95676964 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTTGCCACAGGATGCTG -3'
(R):5'- TGATCTTTCAAGAGGACAACCCAG -3'

Sequencing Primer
(F):5'- TTTGCCACAGGATGCTGAACAC -3'
(R):5'- ATCAGTATGTCATCTCTTCCCCTC -3'
Posted On2017-08-17