Incidental Mutation 'R5234:Slc4a1'
ID 486776
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 042806-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5234 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102252209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 5 (R5W)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably benign
Transcript: ENSMUST00000006749
AA Change: R5W

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: R5W

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,302,823 (GRCm39) T2132M probably damaging Het
Abca8b A T 11: 109,867,420 (GRCm39) F213I possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adamts6 A G 13: 104,630,130 (GRCm39) Y1091C probably damaging Het
Adamtsl4 T C 3: 95,588,230 (GRCm39) M586V probably benign Het
Anapc4 T C 5: 53,006,118 (GRCm39) S336P probably damaging Het
Atp1a4 A T 1: 172,054,737 (GRCm39) I964K possibly damaging Het
Bcan A T 3: 87,903,453 (GRCm39) D246E probably damaging Het
Ccnf G A 17: 24,453,411 (GRCm39) R343* probably null Het
Col6a5 T C 9: 105,741,404 (GRCm39) H2505R probably damaging Het
Dlg5 T A 14: 24,242,930 (GRCm39) M72L probably damaging Het
Dnajc18 T C 18: 35,816,351 (GRCm39) T196A probably benign Het
Dnajc19 T A 3: 34,112,108 (GRCm39) I146F probably benign Het
Espnl A G 1: 91,272,515 (GRCm39) D581G probably benign Het
Fam167a T C 14: 63,689,787 (GRCm39) L28P probably damaging Het
Fra10ac1 T C 19: 38,204,294 (GRCm39) D94G probably damaging Het
Fut8 A G 12: 77,379,004 (GRCm39) H35R probably benign Het
Gad1-ps T A 10: 99,281,188 (GRCm39) noncoding transcript Het
Garin2 T A 12: 78,762,045 (GRCm39) Y236* probably null Het
Idh2 A T 7: 79,745,853 (GRCm39) V333E probably damaging Het
Inpp5f A G 7: 128,265,407 (GRCm39) I121V probably benign Het
Itga1 A T 13: 115,185,839 (GRCm39) Y54* probably null Het
Lax1 A G 1: 133,608,321 (GRCm39) V140A probably benign Het
Ncoa6 A G 2: 155,279,933 (GRCm39) F28L probably benign Het
Or12e10 T C 2: 87,641,112 (GRCm39) V316A probably benign Het
Or1q1 T C 2: 36,887,107 (GRCm39) V95A probably benign Het
Polr2a T C 11: 69,627,666 (GRCm39) I1414V probably benign Het
Ppp1r14b A G 19: 6,954,227 (GRCm39) E115G possibly damaging Het
Prune2 A G 19: 17,096,032 (GRCm39) D512G probably damaging Het
Psmd11 A G 11: 80,319,566 (GRCm39) I19V probably benign Het
Pthlh C A 6: 147,158,592 (GRCm39) G123W probably damaging Het
Qars1 T A 9: 108,391,364 (GRCm39) L572Q probably damaging Het
Rubcn T C 16: 32,656,828 (GRCm39) I516V probably damaging Het
Sgsm3 A T 15: 80,892,145 (GRCm39) S238C probably damaging Het
Slc25a22 C A 7: 141,014,116 (GRCm39) probably benign Het
Tie1 G A 4: 118,339,959 (GRCm39) T356I probably benign Het
Tnn A T 1: 159,972,569 (GRCm39) H344Q possibly damaging Het
Tnrc6c G T 11: 117,651,555 (GRCm39) V1693F probably benign Het
Topaz1 C T 9: 122,619,258 (GRCm39) T1285M possibly damaging Het
Trank1 A T 9: 111,215,535 (GRCm39) S1822C probably damaging Het
Ttll11 A C 2: 35,830,745 (GRCm39) Y209D probably damaging Het
Unc45a C G 7: 79,978,547 (GRCm39) A634P probably benign Het
Vmn2r4 C T 3: 64,305,878 (GRCm39) V515I possibly damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCACAGGGATGGTTAGGTCTC -3'
(R):5'- TAAACGTTAGCTCCTTTAGGGG -3'

Sequencing Primer
(F):5'- CACAGGGATGGTTAGGTCTCTATATG -3'
(R):5'- GGGACCCAGAAGCAACAG -3'
Posted On 2017-08-17