Incidental Mutation 'R5235:Papss2'
ID486779
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32639219 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 215 (N215S)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably benign
Transcript: ENSMUST00000025833
AA Change: N215S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: N215S

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Ido2 A T 8: 24,547,186 I168N probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 splice site probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R7991:Papss2 UTSW 19 32652003 missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAACAGGTGGTGGAACTTTTGC -3'
(R):5'- TGAAGTATAGTATATCACACGTGCG -3'

Sequencing Primer
(F):5'- GTGGAACTTTTGCAGGAGC -3'
(R):5'- CACACACACTGAAGGTAGTTTTAAAG -3'
Posted On2017-08-17