Incidental Mutation 'R5254:Lrrk1'
ID486786
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 042825-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5254 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66307107 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 372 (N372I)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
AA Change: N372I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: N372I

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,458,398 C296* probably null Het
Adam11 T A 11: 102,774,272 Y413* probably null Het
Ankhd1 A G 18: 36,656,715 I907V probably benign Het
Arrdc5 A G 17: 56,297,897 I130T probably benign Het
Asic5 T A 3: 82,020,987 I419K probably damaging Het
Atp4a A T 7: 30,715,530 E248V probably damaging Het
Avil C A 10: 127,011,761 V154L probably benign Het
Bclaf1 T A 10: 20,323,536 H226Q possibly damaging Het
Cald1 A G 6: 34,746,416 probably benign Het
Cd200r4 A C 16: 44,832,090 D27A possibly damaging Het
Cdsn T A 17: 35,552,202 M1K probably null Het
Cfap46 T A 7: 139,678,514 H281L possibly damaging Het
Chaf1a T C 17: 56,062,606 F533L probably benign Het
Chil4 T A 3: 106,219,452 I5F probably benign Het
Ctu2 A T 8: 122,476,588 R48W probably damaging Het
Daam1 A T 12: 71,946,576 H373L unknown Het
Dcaf10 T A 4: 45,370,415 Y328N possibly damaging Het
Dst A T 1: 34,177,931 K1151* probably null Het
Ect2 T C 3: 27,130,070 D503G probably damaging Het
Epm2a C A 10: 11,457,345 D307E probably benign Het
Exph5 A T 9: 53,337,930 D73V probably damaging Het
Fam20b C T 1: 156,705,740 G102D probably damaging Het
Fat2 T C 11: 55,281,175 N2904S probably damaging Het
Flt3 T A 5: 147,375,690 Q147L possibly damaging Het
Fndc11 A G 2: 181,222,163 T254A possibly damaging Het
Galnt15 C T 14: 32,058,287 R514* probably null Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Ggt1 T A 10: 75,579,198 probably null Het
Gm26526 A T 7: 39,589,234 noncoding transcript Het
H2-K1 T C 17: 33,997,462 T237A probably damaging Het
Igf1r T A 7: 68,207,319 S1010T probably damaging Het
Il21 T C 3: 37,227,735 T87A possibly damaging Het
Kmt2b G A 7: 30,569,175 R2010C probably damaging Het
Kmt2c G A 5: 25,314,594 P2173S probably benign Het
Krt1 A T 15: 101,846,368 S512T unknown Het
Krtap16-1 G A 11: 99,985,598 R327* probably null Het
Lama1 T A 17: 67,756,716 I745N probably benign Het
Lyst A T 13: 13,683,070 E2481D probably benign Het
Map2k1 A T 9: 64,187,745 probably benign Het
Mbip A G 12: 56,337,443 V215A probably damaging Het
Mdc1 T A 17: 35,847,922 V398D probably benign Het
Mog T G 17: 37,012,372 I225L probably benign Het
Mrgprx3-ps T A 7: 47,309,436 noncoding transcript Het
Muc5b C T 7: 141,864,540 S3741L probably benign Het
Myo5a A T 9: 75,130,120 I202F probably damaging Het
Myo5b A T 18: 74,700,606 I818F possibly damaging Het
Nfia T A 4: 98,014,297 M262K probably damaging Het
Nisch C T 14: 31,206,567 probably null Het
Nkd1 A G 8: 88,589,194 D64G probably damaging Het
Nt5c2 T A 19: 46,893,560 K284* probably null Het
Olfr1052 A T 2: 86,297,921 Y35F probably damaging Het
Olfr1058 A T 2: 86,386,140 S93T possibly damaging Het
Olfr262 A G 19: 12,241,248 S138P probably damaging Het
Olfr305 A T 7: 86,364,190 V49E possibly damaging Het
Olfr619 T G 7: 103,603,789 I45R probably benign Het
Olfr723 A T 14: 49,928,779 I255N probably damaging Het
Olfr725 C A 14: 50,034,678 A242S possibly damaging Het
Olfr972 A T 9: 39,873,445 T57S possibly damaging Het
Pcdhb17 A T 18: 37,486,825 D556V probably damaging Het
Pcdhga8 A T 18: 37,726,620 D243V probably benign Het
Polq A T 16: 37,089,319 Q2355L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc5a4a C A 10: 76,182,738 Y506* probably null Het
Sp110 G C 1: 85,577,202 probably benign Het
Tarbp1 G A 8: 126,467,156 H336Y probably damaging Het
Tas2r134 T G 2: 51,627,547 F13V probably benign Het
Tgfb2 A G 1: 186,704,483 Y98H probably damaging Het
Tmprss11a C A 5: 86,411,806 V376L probably damaging Het
Tmprss11f T A 5: 86,538,033 K158N probably benign Het
Tnip2 G T 5: 34,503,578 Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 probably null Het
Ttc28 C T 5: 111,271,238 P1398S probably benign Het
Umodl1 T G 17: 30,980,359 I308S possibly damaging Het
Vcan A T 13: 89,691,600 S1942T probably damaging Het
Vmn2r124 T A 17: 18,063,077 N344K probably benign Het
Vmn2r25 C G 6: 123,825,318 C542S probably damaging Het
Wiz T A 17: 32,378,496 probably benign Het
Wrap73 A G 4: 154,155,346 Y343C probably benign Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7728:Lrrk1 UTSW 7 66262715 missense probably benign 0.00
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 66292315 missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCATAAATTGGACAGGGAGCTC -3'
(R):5'- TGTGTGCAGAGAGAACGCAC -3'

Sequencing Primer
(F):5'- CTGTCAGCCTGTTGTCAGCTAG -3'
(R):5'- CACACCTTGTCTAGTGAGAGATCG -3'
Posted On2017-08-17