Mutagenetix > Incidental Mutation

Incidental Mutation 'R5254:Lrrk1'

486786

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

042825-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5254 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66307107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 372 (N372I)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: N372I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: N372I

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207140

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

98% (82/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	G	T	8: 71,458,398	C296*	probably null	Het
Adam11	T	A	11: 102,774,272	Y413*	probably null	Het
Ankhd1	A	G	18: 36,656,715	I907V	probably benign	Het
Arrdc5	A	G	17: 56,297,897	I130T	probably benign	Het
Asic5	T	A	3: 82,020,987	I419K	probably damaging	Het
Atp4a	A	T	7: 30,715,530	E248V	probably damaging	Het
Avil	C	A	10: 127,011,761	V154L	probably benign	Het
Bclaf1	T	A	10: 20,323,536	H226Q	possibly damaging	Het
Cald1	A	G	6: 34,746,416		probably benign	Het
Cd200r4	A	C	16: 44,832,090	D27A	possibly damaging	Het
Cdsn	T	A	17: 35,552,202	M1K	probably null	Het
Cfap46	T	A	7: 139,678,514	H281L	possibly damaging	Het
Chaf1a	T	C	17: 56,062,606	F533L	probably benign	Het
Chil4	T	A	3: 106,219,452	I5F	probably benign	Het
Ctu2	A	T	8: 122,476,588	R48W	probably damaging	Het
Daam1	A	T	12: 71,946,576	H373L	unknown	Het
Dcaf10	T	A	4: 45,370,415	Y328N	possibly damaging	Het
Dst	A	T	1: 34,177,931	K1151*	probably null	Het
Ect2	T	C	3: 27,130,070	D503G	probably damaging	Het
Epm2a	C	A	10: 11,457,345	D307E	probably benign	Het
Exph5	A	T	9: 53,337,930	D73V	probably damaging	Het
Fam20b	C	T	1: 156,705,740	G102D	probably damaging	Het
Fat2	T	C	11: 55,281,175	N2904S	probably damaging	Het
Flt3	T	A	5: 147,375,690	Q147L	possibly damaging	Het
Fndc11	A	G	2: 181,222,163	T254A	possibly damaging	Het
Galnt15	C	T	14: 32,058,287	R514*	probably null	Het
Gbgt1	A	G	2: 28,505,208	D286G	probably damaging	Het
Ggt1	T	A	10: 75,579,198		probably null	Het
Gm26526	A	T	7: 39,589,234		noncoding transcript	Het
H2-K1	T	C	17: 33,997,462	T237A	probably damaging	Het
Igf1r	T	A	7: 68,207,319	S1010T	probably damaging	Het
Il21	T	C	3: 37,227,735	T87A	possibly damaging	Het
Kmt2b	G	A	7: 30,569,175	R2010C	probably damaging	Het
Kmt2c	G	A	5: 25,314,594	P2173S	probably benign	Het
Krt1	A	T	15: 101,846,368	S512T	unknown	Het
Krtap16-1	G	A	11: 99,985,598	R327*	probably null	Het
Lama1	T	A	17: 67,756,716	I745N	probably benign	Het
Lyst	A	T	13: 13,683,070	E2481D	probably benign	Het
Map2k1	A	T	9: 64,187,745		probably benign	Het
Mbip	A	G	12: 56,337,443	V215A	probably damaging	Het
Mdc1	T	A	17: 35,847,922	V398D	probably benign	Het
Mog	T	G	17: 37,012,372	I225L	probably benign	Het
Mrgprx3-ps	T	A	7: 47,309,436		noncoding transcript	Het
Muc5b	C	T	7: 141,864,540	S3741L	probably benign	Het
Myo5a	A	T	9: 75,130,120	I202F	probably damaging	Het
Myo5b	A	T	18: 74,700,606	I818F	possibly damaging	Het
Nfia	T	A	4: 98,014,297	M262K	probably damaging	Het
Nisch	C	T	14: 31,206,567		probably null	Het
Nkd1	A	G	8: 88,589,194	D64G	probably damaging	Het
Nt5c2	T	A	19: 46,893,560	K284*	probably null	Het
Olfr1052	A	T	2: 86,297,921	Y35F	probably damaging	Het
Olfr1058	A	T	2: 86,386,140	S93T	possibly damaging	Het
Olfr262	A	G	19: 12,241,248	S138P	probably damaging	Het
Olfr305	A	T	7: 86,364,190	V49E	possibly damaging	Het
Olfr619	T	G	7: 103,603,789	I45R	probably benign	Het
Olfr723	A	T	14: 49,928,779	I255N	probably damaging	Het
Olfr725	C	A	14: 50,034,678	A242S	possibly damaging	Het
Olfr972	A	T	9: 39,873,445	T57S	possibly damaging	Het
Pcdhb17	A	T	18: 37,486,825	D556V	probably damaging	Het
Pcdhga8	A	T	18: 37,726,620	D243V	probably benign	Het
Polq	A	T	16: 37,089,319	Q2355L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc5a4a	C	A	10: 76,182,738	Y506*	probably null	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tarbp1	G	A	8: 126,467,156	H336Y	probably damaging	Het
Tas2r134	T	G	2: 51,627,547	F13V	probably benign	Het
Tgfb2	A	G	1: 186,704,483	Y98H	probably damaging	Het
Tmprss11a	C	A	5: 86,411,806	V376L	probably damaging	Het
Tmprss11f	T	A	5: 86,538,033	K158N	probably benign	Het
Tnip2	G	T	5: 34,503,578	Q177K	probably damaging	Het
Trp53inp1	T	A	4: 11,165,075		probably null	Het
Ttc28	C	T	5: 111,271,238	P1398S	probably benign	Het
Umodl1	T	G	17: 30,980,359	I308S	possibly damaging	Het
Vcan	A	T	13: 89,691,600	S1942T	probably damaging	Het
Vmn2r124	T	A	17: 18,063,077	N344K	probably benign	Het
Vmn2r25	C	G	6: 123,825,318	C542S	probably damaging	Het
Wiz	T	A	17: 32,378,496		probably benign	Het
Wrap73	A	G	4: 154,155,346	Y343C	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGCATAAATTGGACAGGGAGCTC -3'
(R):5'- TGTGTGCAGAGAGAACGCAC -3'

Sequencing Primer
(F):5'- CTGTCAGCCTGTTGTCAGCTAG -3'
(R):5'- CACACCTTGTCTAGTGAGAGATCG -3'

Posted On

2017-08-17