Incidental Mutation 'R5254:Wiz'
ID 486788
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Name widely-interspaced zinc finger motifs
Synonyms
MMRRC Submission 042825-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5254 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32573029-32608413 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 32597470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169280] [ENSMUST00000170617] [ENSMUST00000171728]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064694
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087699
Predicted Effect probably benign
Transcript: ENSMUST00000087703
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169280
SMART Domains Protein: ENSMUSP00000129700
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171728
SMART Domains Protein: ENSMUSP00000130054
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180608
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,911,042 (GRCm39) C296* probably null Het
Adam11 T A 11: 102,665,098 (GRCm39) Y413* probably null Het
Ankhd1 A G 18: 36,789,768 (GRCm39) I907V probably benign Het
Arrdc5 A G 17: 56,604,897 (GRCm39) I130T probably benign Het
Asic5 T A 3: 81,928,294 (GRCm39) I419K probably damaging Het
Atp4a A T 7: 30,414,955 (GRCm39) E248V probably damaging Het
Avil C A 10: 126,847,630 (GRCm39) V154L probably benign Het
Bclaf1 T A 10: 20,199,282 (GRCm39) H226Q possibly damaging Het
Cald1 A G 6: 34,723,351 (GRCm39) probably benign Het
Cd200r4 A C 16: 44,652,453 (GRCm39) D27A possibly damaging Het
Cdsn T A 17: 35,863,099 (GRCm39) M1K probably null Het
Cfap46 T A 7: 139,258,430 (GRCm39) H281L possibly damaging Het
Chaf1a T C 17: 56,369,606 (GRCm39) F533L probably benign Het
Chil4 T A 3: 106,126,768 (GRCm39) I5F probably benign Het
Ctu2 A T 8: 123,203,327 (GRCm39) R48W probably damaging Het
Daam1 A T 12: 71,993,350 (GRCm39) H373L unknown Het
Dcaf10 T A 4: 45,370,415 (GRCm39) Y328N possibly damaging Het
Dst A T 1: 34,217,012 (GRCm39) K1151* probably null Het
Ect2 T C 3: 27,184,219 (GRCm39) D503G probably damaging Het
Epm2a C A 10: 11,333,089 (GRCm39) D307E probably benign Het
Exph5 A T 9: 53,249,230 (GRCm39) D73V probably damaging Het
Fam20b C T 1: 156,533,310 (GRCm39) G102D probably damaging Het
Fat2 T C 11: 55,172,001 (GRCm39) N2904S probably damaging Het
Flt3 T A 5: 147,312,500 (GRCm39) Q147L possibly damaging Het
Fndc11 A G 2: 180,863,956 (GRCm39) T254A possibly damaging Het
Galnt15 C T 14: 31,780,244 (GRCm39) R514* probably null Het
Gbgt1 A G 2: 28,395,220 (GRCm39) D286G probably damaging Het
Ggt1 T A 10: 75,415,032 (GRCm39) probably null Het
Gm26526 A T 7: 39,238,658 (GRCm39) noncoding transcript Het
H2-K2 T C 17: 34,216,436 (GRCm39) T237A probably damaging Het
Igf1r T A 7: 67,857,067 (GRCm39) S1010T probably damaging Het
Il21 T C 3: 37,281,884 (GRCm39) T87A possibly damaging Het
Kmt2b G A 7: 30,268,600 (GRCm39) R2010C probably damaging Het
Kmt2c G A 5: 25,519,592 (GRCm39) P2173S probably benign Het
Krt1 A T 15: 101,754,803 (GRCm39) S512T unknown Het
Krtap16-1 G A 11: 99,876,424 (GRCm39) R327* probably null Het
Lama1 T A 17: 68,063,711 (GRCm39) I745N probably benign Het
Lrrk1 T A 7: 65,956,855 (GRCm39) N372I probably benign Het
Lyst A T 13: 13,857,655 (GRCm39) E2481D probably benign Het
Map2k1 A T 9: 64,095,027 (GRCm39) probably benign Het
Mbip A G 12: 56,384,228 (GRCm39) V215A probably damaging Het
Mdc1 T A 17: 36,158,814 (GRCm39) V398D probably benign Het
Mog T G 17: 37,323,264 (GRCm39) I225L probably benign Het
Mrgprx3-ps T A 7: 46,959,184 (GRCm39) noncoding transcript Het
Muc5b C T 7: 141,418,277 (GRCm39) S3741L probably benign Het
Myo5a A T 9: 75,037,402 (GRCm39) I202F probably damaging Het
Myo5b A T 18: 74,833,677 (GRCm39) I818F possibly damaging Het
Nfia T A 4: 97,902,534 (GRCm39) M262K probably damaging Het
Nisch C T 14: 30,928,524 (GRCm39) probably null Het
Nkd1 A G 8: 89,315,822 (GRCm39) D64G probably damaging Het
Nt5c2 T A 19: 46,881,999 (GRCm39) K284* probably null Het
Or14a259 A T 7: 86,013,398 (GRCm39) V49E possibly damaging Het
Or4k15b C A 14: 50,272,135 (GRCm39) A242S possibly damaging Het
Or4l1 A T 14: 50,166,236 (GRCm39) I255N probably damaging Het
Or52z14 T G 7: 103,252,996 (GRCm39) I45R probably benign Het
Or5an1c A G 19: 12,218,612 (GRCm39) S138P probably damaging Het
Or5j3 A T 2: 86,128,265 (GRCm39) Y35F probably damaging Het
Or8g55 A T 9: 39,784,741 (GRCm39) T57S possibly damaging Het
Or8k24 A T 2: 86,216,484 (GRCm39) S93T possibly damaging Het
Pcdhb17 A T 18: 37,619,878 (GRCm39) D556V probably damaging Het
Pcdhga8 A T 18: 37,859,673 (GRCm39) D243V probably benign Het
Polq A T 16: 36,909,681 (GRCm39) Q2355L probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc5a4a C A 10: 76,018,572 (GRCm39) Y506* probably null Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Tarbp1 G A 8: 127,193,895 (GRCm39) H336Y probably damaging Het
Tas2r134 T G 2: 51,517,559 (GRCm39) F13V probably benign Het
Tgfb2 A G 1: 186,436,680 (GRCm39) Y98H probably damaging Het
Tmprss11a C A 5: 86,559,665 (GRCm39) V376L probably damaging Het
Tmprss11f T A 5: 86,685,892 (GRCm39) K158N probably benign Het
Tnip2 G T 5: 34,660,922 (GRCm39) Q177K probably damaging Het
Trp53inp1 T A 4: 11,165,075 (GRCm39) probably null Het
Ttc28 C T 5: 111,419,104 (GRCm39) P1398S probably benign Het
Umodl1 T G 17: 31,199,333 (GRCm39) I308S possibly damaging Het
Vcan A T 13: 89,839,719 (GRCm39) S1942T probably damaging Het
Vmn2r124 T A 17: 18,283,339 (GRCm39) N344K probably benign Het
Vmn2r25 C G 6: 123,802,277 (GRCm39) C542S probably damaging Het
Wrap73 A G 4: 154,239,803 (GRCm39) Y343C probably benign Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32,575,893 (GRCm39) missense probably benign 0.43
IGL02176:Wiz APN 17 32,575,876 (GRCm39) missense probably damaging 0.96
IGL02212:Wiz APN 17 32,587,109 (GRCm39) missense probably damaging 1.00
IGL02213:Wiz APN 17 32,586,834 (GRCm39) missense probably benign 0.03
IGL02616:Wiz APN 17 32,578,443 (GRCm39) missense probably damaging 1.00
IGL02654:Wiz APN 17 32,578,324 (GRCm39) missense probably damaging 1.00
IGL02833:Wiz APN 17 32,576,853 (GRCm39) missense probably damaging 1.00
IGL03032:Wiz APN 17 32,575,532 (GRCm39) missense probably benign
E0370:Wiz UTSW 17 32,574,092 (GRCm39) missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32,578,093 (GRCm39) missense probably damaging 1.00
PIT4494001:Wiz UTSW 17 32,580,905 (GRCm39) missense probably damaging 1.00
R0197:Wiz UTSW 17 32,575,415 (GRCm39) missense probably damaging 1.00
R0207:Wiz UTSW 17 32,576,007 (GRCm39) missense probably damaging 1.00
R0701:Wiz UTSW 17 32,575,415 (GRCm39) missense probably damaging 1.00
R0883:Wiz UTSW 17 32,575,415 (GRCm39) missense probably damaging 1.00
R1055:Wiz UTSW 17 32,606,616 (GRCm39) missense probably damaging 0.99
R1968:Wiz UTSW 17 32,578,346 (GRCm39) missense probably damaging 1.00
R2225:Wiz UTSW 17 32,575,899 (GRCm39) missense probably damaging 1.00
R2423:Wiz UTSW 17 32,580,859 (GRCm39) missense probably damaging 1.00
R2860:Wiz UTSW 17 32,580,680 (GRCm39) missense probably damaging 1.00
R2861:Wiz UTSW 17 32,580,680 (GRCm39) missense probably damaging 1.00
R3056:Wiz UTSW 17 32,576,671 (GRCm39) missense probably benign 0.01
R3755:Wiz UTSW 17 32,578,106 (GRCm39) missense probably damaging 1.00
R3885:Wiz UTSW 17 32,576,012 (GRCm39) missense possibly damaging 0.48
R3933:Wiz UTSW 17 32,576,872 (GRCm39) missense probably damaging 1.00
R4038:Wiz UTSW 17 32,578,198 (GRCm39) missense probably damaging 1.00
R4118:Wiz UTSW 17 32,588,331 (GRCm39) utr 3 prime probably benign
R4181:Wiz UTSW 17 32,586,959 (GRCm39) missense probably damaging 1.00
R4651:Wiz UTSW 17 32,576,655 (GRCm39) missense probably damaging 1.00
R4822:Wiz UTSW 17 32,575,411 (GRCm39) nonsense probably null
R4891:Wiz UTSW 17 32,576,602 (GRCm39) missense possibly damaging 0.85
R4923:Wiz UTSW 17 32,580,570 (GRCm39) missense probably benign 0.01
R5014:Wiz UTSW 17 32,578,340 (GRCm39) missense probably damaging 1.00
R5194:Wiz UTSW 17 32,596,822 (GRCm39) utr 3 prime probably benign
R5944:Wiz UTSW 17 32,576,671 (GRCm39) missense probably benign 0.01
R6015:Wiz UTSW 17 32,606,574 (GRCm39) missense probably damaging 0.99
R6263:Wiz UTSW 17 32,579,417 (GRCm39) splice site probably null
R6571:Wiz UTSW 17 32,578,298 (GRCm39) missense probably damaging 1.00
R6823:Wiz UTSW 17 32,579,395 (GRCm39) missense probably damaging 0.99
R7014:Wiz UTSW 17 32,580,840 (GRCm39) missense probably damaging 0.98
R7051:Wiz UTSW 17 32,580,507 (GRCm39) missense probably damaging 1.00
R7144:Wiz UTSW 17 32,576,602 (GRCm39) missense possibly damaging 0.85
R7221:Wiz UTSW 17 32,578,139 (GRCm39) missense probably benign 0.03
R7260:Wiz UTSW 17 32,578,085 (GRCm39) missense probably damaging 0.99
R7453:Wiz UTSW 17 32,598,049 (GRCm39) missense probably benign 0.00
R7849:Wiz UTSW 17 32,576,760 (GRCm39) missense probably benign 0.26
R8686:Wiz UTSW 17 32,586,821 (GRCm39) missense probably damaging 1.00
R9150:Wiz UTSW 17 32,586,809 (GRCm39) missense probably benign 0.31
R9298:Wiz UTSW 17 32,580,714 (GRCm39) missense probably benign
R9564:Wiz UTSW 17 32,575,939 (GRCm39) missense probably benign 0.00
R9565:Wiz UTSW 17 32,575,939 (GRCm39) missense probably benign 0.00
U24488:Wiz UTSW 17 32,606,649 (GRCm39) missense probably damaging 1.00
X0026:Wiz UTSW 17 32,606,732 (GRCm39) start codon destroyed probably null 0.94
Z1176:Wiz UTSW 17 32,580,469 (GRCm39) missense probably damaging 1.00
Z1177:Wiz UTSW 17 32,576,752 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGAGCTTGGCATAAGGTTTCATAG -3'
(R):5'- TGGCCTTGACGCAATACCTC -3'

Sequencing Primer
(F):5'- GGCATAAGGTTTCATAGTTCTCAC -3'
(R):5'- CTTGACGCAATACCTCTGGAAAGG -3'
Posted On 2017-08-17