Incidental Mutation 'R5255:Ddx51'
ID486790
Institutional Source Beutler Lab
Gene Symbol Ddx51
Ensembl Gene ENSMUSG00000029504
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Synonyms
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110653451-110660496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110656042 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 390 (T390N)
Ref Sequence ENSEMBL: ENSMUSP00000031478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031478] [ENSMUST00000042147] [ENSMUST00000148773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031478
AA Change: T390N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031478
Gene: ENSMUSG00000029504
AA Change: T390N

DomainStartEndE-ValueType
low complexity region 50 75 N/A INTRINSIC
DEXDc 189 442 4.04e-40 SMART
HELICc 491 573 2.86e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042147
SMART Domains Protein: ENSMUSP00000038263
Gene: ENSMUSG00000033294

DomainStartEndE-ValueType
Pfam:CBF 305 453 2.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145712
Predicted Effect probably benign
Transcript: ENSMUST00000148773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199795
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Ddx51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Ddx51 APN 5 110655863 missense probably benign 0.00
IGL01688:Ddx51 APN 5 110655647 missense probably benign 0.37
IGL02993:Ddx51 APN 5 110655621 missense possibly damaging 0.93
IGL03149:Ddx51 APN 5 110653734 missense probably benign
R1659:Ddx51 UTSW 5 110655120 missense probably damaging 0.99
R2036:Ddx51 UTSW 5 110656625 missense probably benign 0.01
R2211:Ddx51 UTSW 5 110655768 missense probably damaging 1.00
R4705:Ddx51 UTSW 5 110655308 missense probably damaging 1.00
R5239:Ddx51 UTSW 5 110653648 missense probably benign
R5711:Ddx51 UTSW 5 110654924 missense probably benign 0.03
R5966:Ddx51 UTSW 5 110656851 missense probably damaging 1.00
R6970:Ddx51 UTSW 5 110656862 missense probably damaging 1.00
R7374:Ddx51 UTSW 5 110657132 missense probably damaging 1.00
R7664:Ddx51 UTSW 5 110656919 critical splice donor site probably null
Z1176:Ddx51 UTSW 5 110654558 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGACAGCATGCACCAGTC -3'
(R):5'- AAGGTGTACTTCCCCGAGTTTTC -3'

Sequencing Primer
(F):5'- GCAGCCTTCTACAGTGAGG -3'
(R):5'- GAGTTTTCATCCACCTCAGCTGTG -3'
Posted On2017-08-17