Mutagenetix > Incidental Mutation

Incidental Mutation 'R5272:Dicer1'

486799

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e, Dicer1, 1110006F08Rik

MMRRC Submission

042836-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5272 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104654001-104718211 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104670499 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1022 (I1022T)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: I1022T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: I1022T

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6a	A	G	3: 32,772,759 (GRCm39)	E245G	probably damaging	Het
Arsb	A	T	13: 93,930,670 (GRCm39)	T213S	possibly damaging	Het
Cep152	G	A	2: 125,452,950 (GRCm39)	T374I	probably benign	Het
Crx	C	T	7: 15,602,210 (GRCm39)	C156Y	probably damaging	Het
Csmd1	T	A	8: 16,249,958 (GRCm39)	T1007S	probably damaging	Het
Cyp19a1	A	T	9: 54,083,898 (GRCm39)	C164S	probably benign	Het
Ddx55	A	T	5: 124,696,092 (GRCm39)	I137F	possibly damaging	Het
Dgkg	C	A	16: 22,407,044 (GRCm39)		probably null	Het
Dis3l2	T	C	1: 86,901,126 (GRCm39)	V439A	possibly damaging	Het
Dnah5	T	C	15: 28,350,811 (GRCm39)	V2611A	probably benign	Het
Dnah6	A	G	6: 73,104,844 (GRCm39)		probably null	Het
Ercc6	A	T	14: 32,240,985 (GRCm39)	K170*	probably null	Het
Fibcd1	A	T	2: 31,706,635 (GRCm39)	C399S	probably damaging	Het
Fibcd1	G	T	2: 31,706,636 (GRCm39)	N398K	probably damaging	Het
Fnbp4	G	A	2: 90,583,459 (GRCm39)	M327I	probably benign	Het
Fryl	A	T	5: 73,222,479 (GRCm39)	L256*	probably null	Het
Galr1	T	A	18: 82,423,761 (GRCm39)	Y172F	probably benign	Het
Gpi1	T	C	7: 33,920,115 (GRCm39)	N186S	probably damaging	Het
Kcnh8	A	G	17: 53,212,043 (GRCm39)	I614V	probably damaging	Het
Krt23	A	T	11: 99,369,099 (GRCm39)	I398N	probably damaging	Het
Mia3	G	A	1: 183,109,125 (GRCm39)	R656*	probably null	Het
Mup6	G	C	4: 60,005,922 (GRCm39)	G138A	probably damaging	Het
Nectin3	A	G	16: 46,268,839 (GRCm39)	V521A	possibly damaging	Het
Nhsl3	T	C	4: 129,118,005 (GRCm39)	T208A	possibly damaging	Het
Nphs1	A	G	7: 30,181,067 (GRCm39)	E1096G	possibly damaging	Het
Or8s5	G	A	15: 98,238,246 (GRCm39)	A208V	probably benign	Het
Panx1	C	T	9: 14,956,152 (GRCm39)		probably null	Het
Pcdhb4	A	G	18: 37,440,819 (GRCm39)	Y43C	probably benign	Het
Plbd1	A	G	6: 136,617,156 (GRCm39)	Y62H	probably damaging	Het
Rab40b	A	G	11: 121,248,134 (GRCm39)	V190A	probably damaging	Het
Ryr3	T	C	2: 112,483,558 (GRCm39)	E4063G	probably damaging	Het
Smlr1	T	C	10: 25,411,925 (GRCm39)	I21V	probably benign	Het
Tenm4	T	A	7: 96,523,410 (GRCm39)	Y1614N	probably damaging	Het
Tesmin	C	A	19: 3,456,992 (GRCm39)	A257E	probably damaging	Het
Tgif1	A	G	17: 71,153,249 (GRCm39)	L34P	probably damaging	Het
Ticrr	C	A	7: 79,319,353 (GRCm39)	T446K	probably benign	Het
Tmc7	A	G	7: 118,160,276 (GRCm39)	I187T	probably benign	Het
Tpst2	T	A	5: 112,455,818 (GRCm39)	V119E	probably damaging	Het
Trf	A	T	9: 103,105,177 (GRCm39)	M45K	probably damaging	Het
Trim45	T	C	3: 100,837,235 (GRCm39)	C524R	probably damaging	Het
Ttc27	G	A	17: 75,049,972 (GRCm39)	V293I	probably damaging	Het
Ugt1a6b	C	T	1: 88,034,949 (GRCm39)	R96C	possibly damaging	Het
Vit	A	G	17: 78,894,264 (GRCm39)	Q222R	probably benign	Het
Zfp148	T	A	16: 33,316,594 (GRCm39)	V380D	probably damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104,663,031 (GRCm39)	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104,672,586 (GRCm39)	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104,657,869 (GRCm39)	nonsense	probably null
IGL01597:Dicer1	APN	12	104,671,469 (GRCm39)	nonsense	probably null
IGL01636:Dicer1	APN	12	104,688,500 (GRCm39)	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104,669,046 (GRCm39)	nonsense	probably null
IGL01765:Dicer1	APN	12	104,672,999 (GRCm39)	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104,670,439 (GRCm39)	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104,668,812 (GRCm39)	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104,663,279 (GRCm39)	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104,663,294 (GRCm39)	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104,681,091 (GRCm39)	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104,671,388 (GRCm39)	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104,681,165 (GRCm39)	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104,679,366 (GRCm39)	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104,678,456 (GRCm39)	missense	probably damaging	0.98
everest	UTSW	12	104,671,387 (GRCm39)	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104,662,803 (GRCm39)	missense	probably benign
R0032:Dicer1	UTSW	12	104,671,057 (GRCm39)	nonsense	probably null
R0032:Dicer1	UTSW	12	104,671,057 (GRCm39)	nonsense	probably null
R0219:Dicer1	UTSW	12	104,658,384 (GRCm39)	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104,668,710 (GRCm39)	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104,668,710 (GRCm39)	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104,670,433 (GRCm39)	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104,697,323 (GRCm39)	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104,668,801 (GRCm39)	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104,668,889 (GRCm39)	missense	probably benign
R0502:Dicer1	UTSW	12	104,671,319 (GRCm39)	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104,657,917 (GRCm39)	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104,669,100 (GRCm39)	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104,668,750 (GRCm39)	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104,672,560 (GRCm39)	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104,673,123 (GRCm39)	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104,673,144 (GRCm39)	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104,657,866 (GRCm39)	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104,695,401 (GRCm39)	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104,695,502 (GRCm39)	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104,688,228 (GRCm39)	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104,679,415 (GRCm39)	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104,675,064 (GRCm39)	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104,666,673 (GRCm39)	missense	probably benign
R1815:Dicer1	UTSW	12	104,688,410 (GRCm39)	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104,688,410 (GRCm39)	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104,669,143 (GRCm39)	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104,679,473 (GRCm39)	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104,688,290 (GRCm39)	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104,669,208 (GRCm39)	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104,697,297 (GRCm39)	missense	possibly damaging	0.95
R2203:Dicer1	UTSW	12	104,697,297 (GRCm39)	missense	possibly damaging	0.95
R2243:Dicer1	UTSW	12	104,696,447 (GRCm39)	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104,695,487 (GRCm39)	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104,671,373 (GRCm39)	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104,672,536 (GRCm39)	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104,671,010 (GRCm39)	nonsense	probably null
R4776:Dicer1	UTSW	12	104,658,705 (GRCm39)	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104,662,850 (GRCm39)	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104,679,325 (GRCm39)	missense	probably benign
R5202:Dicer1	UTSW	12	104,660,990 (GRCm39)	nonsense	probably null
R5363:Dicer1	UTSW	12	104,669,410 (GRCm39)	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104,671,387 (GRCm39)	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104,662,721 (GRCm39)	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104,662,982 (GRCm39)	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104,697,282 (GRCm39)	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104,675,108 (GRCm39)	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104,678,537 (GRCm39)	missense	probably benign
R7407:Dicer1	UTSW	12	104,688,610 (GRCm39)	nonsense	probably null
R7471:Dicer1	UTSW	12	104,660,969 (GRCm39)	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104,671,429 (GRCm39)	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104,672,956 (GRCm39)	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104,675,059 (GRCm39)	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104,670,328 (GRCm39)	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104,658,391 (GRCm39)	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104,669,077 (GRCm39)	nonsense	probably null
R8213:Dicer1	UTSW	12	104,668,952 (GRCm39)	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104,657,865 (GRCm39)	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104,668,936 (GRCm39)	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104,694,704 (GRCm39)	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104,690,300 (GRCm39)	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104,679,415 (GRCm39)	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104,670,991 (GRCm39)	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104,695,499 (GRCm39)	missense	possibly damaging	0.48
R9505:Dicer1	UTSW	12	104,697,297 (GRCm39)	missense	possibly damaging	0.95
R9636:Dicer1	UTSW	12	104,688,406 (GRCm39)	nonsense	probably null
R9682:Dicer1	UTSW	12	104,672,484 (GRCm39)	missense	probably damaging	1.00
X0018:Dicer1	UTSW	12	104,663,193 (GRCm39)	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104,697,279 (GRCm39)	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- TCAAATTTCTGGCCAGCAACAC -3'
(R):5'- AAACTTGGGTTTTCCTGGCC -3'

Sequencing Primer
(F):5'- GGCATACCTAAAATCCACGGG -3'
(R):5'- CACTGGTGCATTGGGAATCAC -3'

Posted On

2017-08-17