Incidental Mutation 'R5238:Col20a1'
ID486800
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
Synonyms1700051I12Rik
MMRRC Submission 042809-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5238 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180998586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 512 (V512A)
Ref Sequence ENSEMBL: ENSMUSP00000153871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
Predicted Effect probably damaging
Transcript: ENSMUST00000108856
AA Change: V554A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: V554A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149179
AA Change: V512A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: V512A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152473
Predicted Effect probably damaging
Transcript: ENSMUST00000228434
AA Change: V512A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,163,368 probably null Het
Adamtsl5 C T 10: 80,345,358 G63D probably damaging Het
Armc9 T A 1: 86,199,847 M68K probably benign Het
Atad2 A C 15: 58,108,337 H381Q possibly damaging Het
Bclaf1 T G 10: 20,332,384 probably benign Het
Cbwd1 G T 19: 24,920,630 T382K probably damaging Het
Ccdc188 A G 16: 18,219,174 E238G probably damaging Het
Cldn19 G T 4: 119,255,733 C54F probably damaging Het
Clip1 T C 5: 123,647,883 D246G probably damaging Het
Cyfip1 G T 7: 55,892,031 A355S probably benign Het
Dffa T G 4: 149,104,303 L18R probably benign Het
Dnah8 G A 17: 30,790,917 E3761K probably damaging Het
Dusp10 A G 1: 184,037,013 T59A possibly damaging Het
Eed T C 7: 89,976,965 S67G probably benign Het
Fam181a C T 12: 103,316,133 A99V probably benign Het
Gm12185 G A 11: 48,908,217 T483I possibly damaging Het
Htr3b A T 9: 48,937,242 C234* probably null Het
Kidins220 C A 12: 25,003,010 T433K probably benign Het
Man2a1 T C 17: 64,636,507 Y186H probably damaging Het
Mcm9 G T 10: 53,629,997 S60R possibly damaging Het
Mst1r T A 9: 107,907,574 C144S probably damaging Het
Nckap5 A G 1: 126,027,724 C364R probably damaging Het
Nptx2 T C 5: 144,556,231 I376T probably damaging Het
Olfr237-ps1 T C 6: 43,154,027 S241P probably damaging Het
Otogl A T 10: 107,768,973 C2191S probably damaging Het
Plxdc2 T A 2: 16,650,215 F208L probably damaging Het
Robo3 A C 9: 37,416,879 Y1339D probably damaging Het
Rsph9 G T 17: 46,135,082 Y42* probably null Het
Slc39a1 T A 3: 90,249,395 L86Q probably null Het
Slfn8 T C 11: 83,013,388 D392G probably damaging Het
Tiprl A G 1: 165,215,768 V263A probably benign Het
Tmub2 A G 11: 102,284,994 probably benign Het
Trpm1 T A 7: 64,268,954 F681I probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uba3 A T 6: 97,201,935 C68* probably null Het
Vmn1r158 T A 7: 22,790,374 M137L probably benign Het
Vmn1r50 C T 6: 90,107,483 A70V possibly damaging Het
Wwc1 T C 11: 35,875,896 K511E probably benign Het
Zfp600 T C 4: 146,195,171 probably null Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 splice site probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R8183:Col20a1 UTSW 2 180998414 missense
R8188:Col20a1 UTSW 2 181016333 critical splice donor site probably null
R8331:Col20a1 UTSW 2 180996766 missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180998705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTCTCCACGTCACCTG -3'
(R):5'- AGGGTTATCTGTGGTCTCCC -3'

Sequencing Primer
(F):5'- GTCACCTGGCCGCCCTC -3'
(R):5'- TGGGAATTGAATGACTCCCC -3'
Posted On2017-08-17