Mutagenetix > Incidental Mutations

Incidental Mutation 'R4990:Cds1'

486816

Institutional Source

Beutler Lab

Gene Symbol

Cds1

Ensembl Gene

ENSMUSG00000029330

Gene Name

CDP-diacylglycerol synthase 1

Synonyms

4833409J18Rik, phosphatidate cytidylyltransferase

MMRRC Submission

042584-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R4990 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101765130-101823858 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101798379 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 148 (Y148C)

Ref Sequence

ENSEMBL: ENSMUSP00000031273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031273]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031273
AA Change: Y148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: Y148C

Domain	Start	End	E-Value	Type
low complexity region	7	29	N/A	INTRINSIC
Pfam:CTP_transf_1	87	417	6.4e-89	PFAM
low complexity region	427	439	N/A	INTRINSIC

Meta Mutation Damage Score

0.8680

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,294,939	I1135V	possibly damaging	Het
Abca14	G	A	7: 120,312,165	R1324K	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Aplnr	G	A	2: 85,137,377	V249M	probably damaging	Het
Atg16l1	A	G	1: 87,789,369	K471R	probably benign	Het
Cacna1b	A	G	2: 24,678,874		probably null	Het
Ccdc152	A	G	15: 3,301,157	I12T	probably benign	Het
Cenpe	T	A	3: 135,256,640	L1989Q	probably damaging	Het
Cep295	T	C	9: 15,332,138	Q1674R	probably damaging	Het
D930020B18Rik	C	G	10: 121,654,761	P89A	probably damaging	Het
D930020B18Rik	C	T	10: 121,654,762	P89L	probably damaging	Het
Dock2	T	C	11: 34,695,251	M535V	probably damaging	Het
Dscam	A	G	16: 96,825,515	V398A	probably benign	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Eno3	A	G	11: 70,658,647	D98G	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Fbxw18	T	C	9: 109,688,393	E414G	probably damaging	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm5861	A	T	5: 11,186,414	E138V	probably damaging	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hnrnpr	A	G	4: 136,329,379	E230G	probably damaging	Het
Hnrnpr	G	A	4: 136,336,298	V239I	probably damaging	Het
Ipo11	A	T	13: 106,860,887	I688K	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Kcnh7	T	C	2: 62,734,288	N876D	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lrp2	G	T	2: 69,481,388	T2582K	probably benign	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Megf6	A	G	4: 154,267,226	E1132G	possibly damaging	Het
Mesp1	A	G	7: 79,792,921	Y203H	probably damaging	Het
Ms4a4a	T	C	19: 11,378,837	S29P	probably benign	Het
Nbeal2	A	C	9: 110,634,803	C1174G	probably benign	Het
Neb	C	T	2: 52,255,546	V2989I	probably benign	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Nt5e	A	G	9: 88,355,593	N192S	probably benign	Het
Ntng1	A	T	3: 110,135,261		probably null	Het
Olfr1215	A	T	2: 89,001,472	I272K	probably damaging	Het
Olfr1229	A	T	2: 89,283,327		probably null	Het
Olfr411	A	G	11: 74,347,197	I129T	probably damaging	Het
Olfr45	G	A	7: 140,691,447	E181K	probably damaging	Het
Panx1	A	G	9: 15,010,217	Y121H	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Pgm3	T	A	9: 86,558,412	I409F	probably damaging	Het
Plg	T	C	17: 12,411,510	Y645H	probably benign	Het
Pon3	T	C	6: 5,221,619	H337R	probably benign	Het
Rasa2	A	G	9: 96,591,989	I162T	probably benign	Het
Ror1	A	G	4: 100,441,964	I845V	probably benign	Het
Rpl4	T	C	9: 64,174,885	V22A	probably benign	Het
Ryr3	G	T	2: 112,635,777	Q4746K	probably damaging	Het
Ryr3	T	C	2: 112,909,973	N531S	probably damaging	Het
Sbno1	A	T	5: 124,400,165	F571I	probably damaging	Het
Scarf1	T	C	11: 75,526,015	V761A	probably benign	Het
Sec22b	T	G	3: 97,921,111		probably null	Het
Slc45a2	A	G	15: 11,001,150	M112V	probably benign	Het
Snai3	G	A	8: 122,456,332	T158M	possibly damaging	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Trappc11	A	T	8: 47,490,895	D1127E	probably benign	Het
Triobp	C	A	15: 78,967,005	A453D	probably benign	Het
Tubd1	T	C	11: 86,557,839	L295P	probably damaging	Het
Ulk4	C	T	9: 121,192,786	V620I	probably benign	Het
Vmn2r39	A	G	7: 9,023,676	I442T	probably benign	Het
Wwc1	T	C	11: 35,876,566	T413A	probably benign	Het
Zfp131	A	C	13: 119,782,913	V77G	probably damaging	Het
Zfyve26	T	C	12: 79,287,833	D137G	probably damaging	Het

Other mutations in Cds1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cds1	APN	5	101809901	missense	probably damaging	0.99
IGL02052:Cds1	APN	5	101814472	missense	probably benign	0.01
IGL02238:Cds1	APN	5	101814436	missense	possibly damaging	0.84
IGL02449:Cds1	APN	5	101815928	missense	probably damaging	1.00
IGL02833:Cds1	APN	5	101814466	missense	possibly damaging	0.81
IGL02973:Cds1	APN	5	101812510	missense	probably damaging	0.99
IGL02987:Cds1	APN	5	101812525	missense	possibly damaging	0.85
R0076:Cds1	UTSW	5	101817840	splice site	probably benign
R0200:Cds1	UTSW	5	101814433	missense	probably damaging	0.97
R0285:Cds1	UTSW	5	101797038	missense	probably damaging	1.00
R0608:Cds1	UTSW	5	101814433	missense	probably damaging	0.97
R0932:Cds1	UTSW	5	101797025	missense	probably damaging	0.99
R1444:Cds1	UTSW	5	101798379	missense	probably damaging	1.00
R1585:Cds1	UTSW	5	101817962	splice site	probably benign
R1781:Cds1	UTSW	5	101812550	missense	possibly damaging	0.78
R2126:Cds1	UTSW	5	101812550	missense	probably benign	0.34
R4804:Cds1	UTSW	5	101821523	missense	probably damaging	1.00
R5176:Cds1	UTSW	5	101781420	missense	possibly damaging	0.87
R5330:Cds1	UTSW	5	101798495	missense	probably damaging	1.00
R5331:Cds1	UTSW	5	101798495	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCGCTGATCGGTTTAAAGC -3'
(R):5'- CAACCGTTAGCCTAGGGAAC -3'

Sequencing Primer
(F):5'- TTTAAAGCGAAGTTTAAGGTGAGG -3'
(R):5'- GAACCGTTAGCCTAGGGAAC -3'

Posted On

2017-08-17