Incidental Mutation 'R5596:Kcnip1'
ID486824
Institutional Source Beutler Lab
Gene Symbol Kcnip1
Ensembl Gene ENSMUSG00000053519
Gene NameKv channel-interacting protein 1
Synonyms3202002F18Rik, 2900046L02Rik, KCHIP1
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33629339-33993152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33630597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 213 (D213G)
Ref Sequence ENSEMBL: ENSMUSP00000104964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065970] [ENSMUST00000101368] [ENSMUST00000101371] [ENSMUST00000109340]
Predicted Effect probably damaging
Transcript: ENSMUST00000065970
AA Change: D202G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069063
Gene: ENSMUSG00000053519
AA Change: D202G

DomainStartEndE-ValueType
EFh 90 118 2.24e1 SMART
EFh 126 154 8.77e-7 SMART
EFh 174 202 2.83e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101368
AA Change: D174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098919
Gene: ENSMUSG00000053519
AA Change: D174G

DomainStartEndE-ValueType
EFh 62 90 2.24e1 SMART
EFh 98 126 8.77e-7 SMART
EFh 146 174 2.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101371
SMART Domains Protein: ENSMUSP00000098922
Gene: ENSMUSG00000073052

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
internal_repeat_2 36 101 5.51e-11 PROSPERO
internal_repeat_1 68 122 4.83e-23 PROSPERO
internal_repeat_2 99 175 5.51e-11 PROSPERO
internal_repeat_1 122 176 4.83e-23 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000109340
AA Change: D213G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104964
Gene: ENSMUSG00000053519
AA Change: D213G

DomainStartEndE-ValueType
EFh 101 129 2.24e1 SMART
EFh 137 165 8.77e-7 SMART
EFh 185 213 2.83e-1 SMART
Meta Mutation Damage Score 0.7413 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increase susceptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Kcnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Kcnip1 APN 11 33643289 splice site probably benign
IGL00597:Kcnip1 APN 11 33643294 critical splice donor site probably null
IGL01064:Kcnip1 APN 11 33633192 missense probably damaging 1.00
IGL01125:Kcnip1 APN 11 33633202 missense probably damaging 1.00
IGL01324:Kcnip1 APN 11 33645603 start codon destroyed probably null 0.01
IGL01409:Kcnip1 APN 11 33630593 missense probably benign 0.00
IGL02622:Kcnip1 APN 11 33643290 splice site probably benign
R0149:Kcnip1 UTSW 11 33843177 missense probably benign
R0319:Kcnip1 UTSW 11 33651529 splice site probably benign
R0361:Kcnip1 UTSW 11 33843177 missense probably benign
R1314:Kcnip1 UTSW 11 33642481 missense probably damaging 1.00
R3420:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3421:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3422:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R4631:Kcnip1 UTSW 11 33992821 exon noncoding transcript
R4843:Kcnip1 UTSW 11 33644504 missense probably benign 0.00
R5007:Kcnip1 UTSW 11 33642495 missense probably benign 0.05
R5337:Kcnip1 UTSW 11 33642389 intron probably benign
R6058:Kcnip1 UTSW 11 33642478 missense probably damaging 1.00
R6210:Kcnip1 UTSW 11 33645600 missense possibly damaging 0.93
R7086:Kcnip1 UTSW 11 33634629 missense probably damaging 1.00
R7363:Kcnip1 UTSW 11 33634589 missense probably benign 0.00
R7881:Kcnip1 UTSW 11 33633206 missense probably damaging 1.00
R7964:Kcnip1 UTSW 11 33633206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTCCAAAACAAAGTCGG -3'
(R):5'- CATGCAACTCATTGATGGAGC -3'

Sequencing Primer
(F):5'- CCAGGTTTTGTAGAAAGTCTTCAGC -3'
(R):5'- CAACTCATTGATGGAGCATCTTAAAG -3'
Posted On2017-08-18