Incidental Mutation 'R5505:Cmklr1'
ID486825
Institutional Source Beutler Lab
Gene Symbol Cmklr1
Ensembl Gene ENSMUSG00000042190
Gene Namechemokine-like receptor 1
SynonymsChemR23, Gpcr27
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113612354-113650426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 113614929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 4 (D4H)
Ref Sequence ENSEMBL: ENSMUSP00000115784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047936] [ENSMUST00000132065] [ENSMUST00000142854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047936
AA Change: D4H

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036316
Gene: ENSMUSG00000042190
AA Change: D4H

DomainStartEndE-ValueType
Pfam:7tm_1 55 314 2.6e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132065
AA Change: D4H

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121765
Gene: ENSMUSG00000042190
AA Change: D4H

DomainStartEndE-ValueType
Pfam:7tm_1 55 301 5e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142854
AA Change: D4H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygous null mice have defects in immunomodulation of monocyte and neutriphils by chemerin [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Cmklr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Cmklr1 APN 5 113614221 missense probably benign 0.04
IGL02246:Cmklr1 APN 5 113614400 missense probably benign 0.00
IGL02997:Cmklr1 APN 5 113614640 missense probably benign 0.15
R0098:Cmklr1 UTSW 5 113614470 missense probably benign 0.00
R0360:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R0364:Cmklr1 UTSW 5 113614517 missense probably damaging 1.00
R1217:Cmklr1 UTSW 5 113614046 missense probably damaging 1.00
R1702:Cmklr1 UTSW 5 113613842 missense probably benign 0.20
R1862:Cmklr1 UTSW 5 113614407 missense probably damaging 0.96
R4131:Cmklr1 UTSW 5 113614484 missense probably damaging 0.97
R4132:Cmklr1 UTSW 5 113614484 missense probably damaging 0.97
R4611:Cmklr1 UTSW 5 113614869 missense probably benign 0.05
R4647:Cmklr1 UTSW 5 113614640 missense probably damaging 1.00
R5217:Cmklr1 UTSW 5 113614649 missense probably damaging 0.98
R5484:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5486:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5487:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R5504:Cmklr1 UTSW 5 113614929 missense possibly damaging 0.65
R6301:Cmklr1 UTSW 5 113614938 start codon destroyed possibly damaging 0.72
R6994:Cmklr1 UTSW 5 113614922 missense probably damaging 1.00
R7342:Cmklr1 UTSW 5 113614293 missense probably benign 0.00
Z1176:Cmklr1 UTSW 5 113613891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCGATGACAATCACCAGG -3'
(R):5'- GAGACCCAGTCTTCTCTGACATTC -3'

Sequencing Primer
(F):5'- GATGACAATCACCAGGCCGTTG -3'
(R):5'- CTTGCCTACATGAGCATATGTACACG -3'
Posted On2017-08-18