Incidental Mutation 'R0523:Notch2'
ID48683
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Namenotch 2
SynonymsN2, Motch B
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0523 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98013527-98150361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98111598 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 692 (R692H)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
Predicted Effect probably benign
Transcript: ENSMUST00000079812
AA Change: R692H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: R692H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98111675 missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98138655 missense probably benign 0.16
IGL01630:Notch2 APN 3 98146618 missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98146060 missense probably damaging 1.00
IGL01828:Notch2 APN 3 98072613 missense probably damaging 1.00
IGL01998:Notch2 APN 3 98143106 missense probably damaging 1.00
IGL02008:Notch2 APN 3 98147296 missense probably damaging 1.00
IGL02030:Notch2 APN 3 98099421 splice site probably null
IGL02155:Notch2 APN 3 98138490 missense probably damaging 0.98
IGL02268:Notch2 APN 3 98137397 missense probably damaging 1.00
IGL02301:Notch2 APN 3 98141554 missense probably benign 0.08
IGL02336:Notch2 APN 3 98138395 missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98147336 nonsense probably null
IGL02536:Notch2 APN 3 98102407 missense probably benign 0.03
IGL02589:Notch2 APN 3 98104347 critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98116697 splice site probably benign
IGL02691:Notch2 APN 3 98135607 nonsense probably null
IGL02832:Notch2 APN 3 98137373 missense probably benign 0.12
IGL02894:Notch2 APN 3 98102432 nonsense probably null
IGL02902:Notch2 APN 3 98111574 missense probably damaging 1.00
IGL02967:Notch2 APN 3 98146144 missense probably damaging 0.99
IGL03015:Notch2 APN 3 98072649 missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98142956 missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98098108 missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98104462 missense probably damaging 1.00
R0111:Notch2 UTSW 3 98138761 missense probably benign 0.00
R0129:Notch2 UTSW 3 98146620 missense probably benign 0.08
R0143:Notch2 UTSW 3 98146117 missense probably damaging 0.99
R0480:Notch2 UTSW 3 98146537 missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98070970 missense probably benign 0.34
R0531:Notch2 UTSW 3 98102451 splice site probably benign
R0537:Notch2 UTSW 3 98116741 missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98134677 splice site probably null
R1485:Notch2 UTSW 3 98100257 missense probably benign 0.00
R1555:Notch2 UTSW 3 98131340 missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98111575 missense probably damaging 1.00
R1699:Notch2 UTSW 3 98145127 missense probably damaging 1.00
R1765:Notch2 UTSW 3 98121926 missense probably damaging 1.00
R1794:Notch2 UTSW 3 98099547 missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98072755 missense probably damaging 1.00
R2086:Notch2 UTSW 3 98102367 missense probably damaging 1.00
R2099:Notch2 UTSW 3 98115321 missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R3924:Notch2 UTSW 3 98122034 nonsense probably null
R4018:Notch2 UTSW 3 98104565 missense probably damaging 1.00
R4151:Notch2 UTSW 3 98147071 missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98131270 missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4511:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4636:Notch2 UTSW 3 98146104 missense probably benign 0.02
R4661:Notch2 UTSW 3 98135513 missense probably damaging 1.00
R4856:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4886:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4945:Notch2 UTSW 3 98111721 missense probably benign 0.01
R4970:Notch2 UTSW 3 98101636 critical splice donor site probably null
R4974:Notch2 UTSW 3 98139633 missense probably benign 0.39
R5082:Notch2 UTSW 3 98100374 missense probably damaging 1.00
R5112:Notch2 UTSW 3 98101636 critical splice donor site probably null
R5156:Notch2 UTSW 3 98124310 missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98126134 missense probably damaging 1.00
R5539:Notch2 UTSW 3 98137582 missense probably damaging 0.99
R5813:Notch2 UTSW 3 98135428 missense probably benign
R5827:Notch2 UTSW 3 98072862 missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98123923 intron probably benign
R6021:Notch2 UTSW 3 98121972 missense probably damaging 1.00
R6090:Notch2 UTSW 3 98135377 nonsense probably null
R6103:Notch2 UTSW 3 98135743 missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98146293 missense probably benign 0.00
R6168:Notch2 UTSW 3 98145217 missense probably damaging 1.00
R6382:Notch2 UTSW 3 98141543 missense probably damaging 1.00
R6404:Notch2 UTSW 3 98081998 missense probably damaging 1.00
R6419:Notch2 UTSW 3 98100389 critical splice donor site probably null
R6454:Notch2 UTSW 3 98137406 missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98101605 missense probably damaging 1.00
R6629:Notch2 UTSW 3 98120881 missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98138430 missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98134586 missense probably damaging 1.00
R6837:Notch2 UTSW 3 98070854 splice site probably null
R7021:Notch2 UTSW 3 98135446 missense probably benign
R7028:Notch2 UTSW 3 98102387 missense probably damaging 1.00
R7228:Notch2 UTSW 3 98137317 nonsense probably null
R7320:Notch2 UTSW 3 98131327 missense possibly damaging 0.94
R7361:Notch2 UTSW 3 98131402 missense probably benign 0.04
R7562:Notch2 UTSW 3 98113114 missense probably damaging 1.00
R7630:Notch2 UTSW 3 98137508 missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R7748:Notch2 UTSW 3 98138484 missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98142988 missense probably damaging 1.00
R7817:Notch2 UTSW 3 98107127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTTGAACCTTACAGCCTGCC -3'
(R):5'- GGTCAAGTTCCCAACCGACAAACTG -3'

Sequencing Primer
(F):5'- CTGCCTCCGTGAAGTGTCTG -3'
(R):5'- CCGACAAACTGAAGCTATTGTG -3'
Posted On2013-06-12