Incidental Mutation 'R5441:Cers5'
ID486830
Institutional Source Beutler Lab
Gene Symbol Cers5
Ensembl Gene ENSMUSG00000023021
Gene Nameceramide synthase 5
SynonymsCerS5, Trh4, 2310081H14Rik, Lass5
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99734881-99772885 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 99751238 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 50 (K50*)
Ref Sequence ENSEMBL: ENSMUSP00000134988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023762] [ENSMUST00000109035] [ENSMUST00000175876] [ENSMUST00000176248] [ENSMUST00000176627]
Predicted Effect probably null
Transcript: ENSMUST00000023762
AA Change: K101*
SMART Domains Protein: ENSMUSP00000023762
Gene: ENSMUSG00000023021
AA Change: K101*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
low complexity region 343 361 N/A INTRINSIC
low complexity region 366 382 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109035
AA Change: K101*
SMART Domains Protein: ENSMUSP00000104663
Gene: ENSMUSG00000023021
AA Change: K101*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 6e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175876
AA Change: K52*
SMART Domains Protein: ENSMUSP00000134845
Gene: ENSMUSG00000023021
AA Change: K52*

DomainStartEndE-ValueType
HOX 29 91 5.6e-2 SMART
TLC 90 241 1.29e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176248
AA Change: K101*
SMART Domains Protein: ENSMUSP00000135074
Gene: ENSMUSG00000023021
AA Change: K101*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-18 BLAST
HOX 78 140 2.8e-4 SMART
TLC 139 251 1.7e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176627
AA Change: K50*
SMART Domains Protein: ENSMUSP00000134988
Gene: ENSMUSG00000023021
AA Change: K50*

DomainStartEndE-ValueType
HOX 27 89 5.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176970
SMART Domains Protein: ENSMUSP00000135723
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
TLC 1 153 3.49e-25 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TLC (TRAM, LAG1 and CLN8 homology domains) family of proteins. The encoded protein functions in the synthesis of ceramide, a lipid molecule that is involved in a several cellular signaling pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Cers5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Cers5 APN 15 99739655 nonsense probably null
coleman UTSW 15 99751238 nonsense probably null
R0178:Cers5 UTSW 15 99747024 splice site probably benign
R0483:Cers5 UTSW 15 99745914 missense probably damaging 1.00
R0589:Cers5 UTSW 15 99740956 missense probably damaging 1.00
R1433:Cers5 UTSW 15 99745931 nonsense probably null
R1757:Cers5 UTSW 15 99736331 missense probably benign 0.31
R2520:Cers5 UTSW 15 99736381 missense probably damaging 0.97
R3008:Cers5 UTSW 15 99772717 unclassified probably benign
R3010:Cers5 UTSW 15 99772717 unclassified probably benign
R3011:Cers5 UTSW 15 99772717 unclassified probably benign
R4379:Cers5 UTSW 15 99751253 missense probably damaging 1.00
R4732:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4733:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4911:Cers5 UTSW 15 99747079 missense probably damaging 1.00
R6089:Cers5 UTSW 15 99741002 missense probably benign 0.01
R6161:Cers5 UTSW 15 99738663 critical splice donor site probably null
R6247:Cers5 UTSW 15 99745924 missense probably benign 0.03
R6300:Cers5 UTSW 15 99772219 missense probably damaging 1.00
R6312:Cers5 UTSW 15 99747115 missense probably benign 0.11
R6861:Cers5 UTSW 15 99772363 unclassified probably benign
R7780:Cers5 UTSW 15 99739708 missense probably damaging 1.00
R7800:Cers5 UTSW 15 99736241 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCATGTGCCGCACCTATTAGTG -3'
(R):5'- ATAACGGGTTTCTGGTTCCTAG -3'

Sequencing Primer
(F):5'- AGTGCTACTCTCCATTAGTCCATTAG -3'
(R):5'- TCCCTCCATTAATATTCCAATCAGG -3'
Posted On2017-08-18