Incidental Mutation 'R5625:Rasl10b'
ID486847
Institutional Source Beutler Lab
Gene Symbol Rasl10b
Ensembl Gene ENSMUSG00000020684
Gene NameRAS-like, family 10, member B
SynonymsB230331P10Rik, VTS58635
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5625 (G1)
Quality Score73
Status Validated
Chromosome11
Chromosomal Location83409137-83421039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83418814 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 199 (R199L)
Ref Sequence ENSEMBL: ENSMUSP00000132696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021022] [ENSMUST00000052521] [ENSMUST00000108140] [ENSMUST00000147301] [ENSMUST00000164425] [ENSMUST00000175848]
Predicted Effect probably damaging
Transcript: ENSMUST00000021022
AA Change: R199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052521
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108140
AA Change: R199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147301
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164425
AA Change: R199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684
AA Change: R199L

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Meta Mutation Damage Score 0.1530 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have smaller than normal large dense-core vesicles in atrial myocytes and exhibit impaired atrial natriuretic peptide secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Rasl10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Rasl10b APN 11 83417853 missense probably damaging 1.00
R0378:Rasl10b UTSW 11 83418693 missense probably damaging 1.00
R0772:Rasl10b UTSW 11 83417839 splice site probably null
R0773:Rasl10b UTSW 11 83417839 splice site probably null
R0829:Rasl10b UTSW 11 83417839 splice site probably null
R0830:Rasl10b UTSW 11 83417839 splice site probably null
R0831:Rasl10b UTSW 11 83417839 splice site probably null
R1363:Rasl10b UTSW 11 83417839 splice site probably null
R1364:Rasl10b UTSW 11 83417839 splice site probably null
R1365:Rasl10b UTSW 11 83417839 splice site probably null
R1366:Rasl10b UTSW 11 83417839 splice site probably null
R1367:Rasl10b UTSW 11 83417839 splice site probably null
R1368:Rasl10b UTSW 11 83417839 splice site probably null
R1389:Rasl10b UTSW 11 83417839 splice site probably null
R3771:Rasl10b UTSW 11 83418523 missense probably benign 0.04
R4925:Rasl10b UTSW 11 83412679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATCGTGGGCAACAAGC -3'
(R):5'- GGCACTACACTACAGCACTG -3'

Sequencing Primer
(F):5'- GCAACAAGCGCGACCTG -3'
(R):5'- ACCCTCTGATTCTCGTGGGG -3'
Posted On2017-08-28