Incidental Mutation 'R5541:Als2cr12'
ID486851
Institutional Source Beutler Lab
Gene Symbol Als2cr12
Ensembl Gene ENSMUSG00000047528
Gene Nameamyotrophic lateral sclerosis 2 chromosome region 12
Synonyms4933425F06Rik, 4933405P16Rik
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58646903-58695989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58658429 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 384 (M384T)
Ref Sequence ENSEMBL: ENSMUSP00000139420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055313] [ENSMUST00000188772] [ENSMUST00000191252] [ENSMUST00000191565]
Predicted Effect unknown
Transcript: ENSMUST00000055313
AA Change: C383R
SMART Domains Protein: ENSMUSP00000062497
Gene: ENSMUSG00000047528
AA Change: C383R

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188643
Predicted Effect probably benign
Transcript: ENSMUST00000188772
SMART Domains Protein: ENSMUSP00000140780
Gene: ENSMUSG00000047528

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191252
Predicted Effect probably benign
Transcript: ENSMUST00000191565
AA Change: M384T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139420
Gene: ENSMUSG00000047528
AA Change: M384T

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Als2cr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Als2cr12 APN 1 58670394 missense probably damaging 0.98
IGL02549:Als2cr12 APN 1 58659282 missense probably benign 0.05
IGL02647:Als2cr12 APN 1 58670454 missense probably benign
IGL03098:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
PIT4504001:Als2cr12 UTSW 1 58659099 missense probably benign 0.20
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1959:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R1960:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R3815:Als2cr12 UTSW 1 58659005 missense probably damaging 0.98
R4445:Als2cr12 UTSW 1 58666921 missense possibly damaging 0.83
R4617:Als2cr12 UTSW 1 58661442 missense probably benign 0.19
R4720:Als2cr12 UTSW 1 58678348 missense possibly damaging 0.46
R4816:Als2cr12 UTSW 1 58670408 missense probably benign 0.10
R4947:Als2cr12 UTSW 1 58676539 missense probably benign 0.05
R4960:Als2cr12 UTSW 1 58667806 missense probably damaging 0.98
R4970:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5018:Als2cr12 UTSW 1 58690950 missense probably benign
R5112:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5269:Als2cr12 UTSW 1 58691760 missense possibly damaging 0.83
R5426:Als2cr12 UTSW 1 58666886 nonsense probably null
R5845:Als2cr12 UTSW 1 58667778 missense possibly damaging 0.46
R5863:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
R6364:Als2cr12 UTSW 1 58658372 missense probably damaging 0.96
R6430:Als2cr12 UTSW 1 58678289 missense probably damaging 0.98
R6527:Als2cr12 UTSW 1 58692413 start codon destroyed probably null 0.01
R6573:Als2cr12 UTSW 1 58666844 missense probably benign 0.27
R7367:Als2cr12 UTSW 1 58666864 missense probably benign 0.07
R7459:Als2cr12 UTSW 1 58691752 missense possibly damaging 0.46
R7497:Als2cr12 UTSW 1 58678308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGTCCGTAGCTTCCTC -3'
(R):5'- CTAGTTGCCAGTCACCATCAC -3'

Sequencing Primer
(F):5'- TAGCTTCCTCCCAGGGCAG -3'
(R):5'- TCCATTGGAAATATGATCTCCCAAAC -3'
Posted On2017-08-28