Mutagenetix > Incidental Mutations

Incidental Mutation 'R5541:Dhx29'

486854

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

043099-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5541 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112940374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 259 (N259S)

Ref Sequence

ENSEMBL: ENSMUSP00000035244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574] [ENSMUST00000224176]

AlphaFold

Q6PGC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038574
AA Change: N259S

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: N259S

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225929

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226022

Meta Mutation Damage Score

0.0732

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,969	H34R	probably benign	Het
1700113H08Rik	A	G	10: 87,225,946	K86R	probably benign	Het
Abca13	T	C	11: 9,291,545	V1136A	probably benign	Het
Als2cr12	A	G	1: 58,658,429	M384T	probably benign	Het
Arfgap2	G	A	2: 91,275,769	R530H	probably benign	Het
Arhgap30	T	C	1: 171,404,139		probably null	Het
Asb7	T	C	7: 66,679,269	R8G	probably benign	Het
Bod1l	T	C	5: 41,791,933	N2949D	probably benign	Het
Ccdc86	T	C	19: 10,948,554	E227G	probably damaging	Het
Cercam	A	G	2: 29,875,629	D261G	probably benign	Het
Chd9	A	T	8: 91,051,504	E2714D	probably benign	Het
Dcp1a	T	A	14: 30,502,839	S126R	probably damaging	Het
Defa17	T	A	8: 21,656,549	C64S	probably damaging	Het
Depdc5	A	T	5: 32,864,629		probably benign	Het
Dnah6	A	T	6: 73,192,988	L323Q	possibly damaging	Het
Dnah9	T	C	11: 66,145,336	Y416C	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fbxw15	T	G	9: 109,565,430	I106L	probably benign	Het
Gm10610	A	G	7: 83,549,406		noncoding transcript	Het
Gpr22	A	G	12: 31,709,349	F258S	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
H2afy2	T	C	10: 61,747,717	I215V	probably benign	Het
Hspg2	C	T	4: 137,520,551	T1233I	probably damaging	Het
Hspg2	C	A	4: 137,542,825	Q2365K	probably benign	Het
Intu	A	G	3: 40,692,587		probably null	Het
Kdm1b	T	C	13: 47,079,196	M714T	probably damaging	Het
Kif21a	A	G	15: 90,968,113	M924T	probably damaging	Het
Klb	A	T	5: 65,379,234	M636L	probably benign	Het
Klrb1a	G	A	6: 128,609,736	H219Y	probably benign	Het
March10	C	T	11: 105,390,131	D443N	probably damaging	Het
Nos1	A	G	5: 117,905,394	E578G	probably damaging	Het
Olfr1502	T	C	19: 13,861,964	I57T	probably benign	Het
Olfr887	T	C	9: 38,085,123	C96R	probably damaging	Het
Pard3b	A	G	1: 61,639,343	Y34C	probably damaging	Het
Pcdh17	T	A	14: 84,447,416	V441E	probably damaging	Het
Pde6g	A	T	11: 120,448,172	I64N	probably damaging	Het
Pdia4	C	T	6: 47,796,637	V593M	probably damaging	Het
Pnn	T	G	12: 59,071,930	V433G	possibly damaging	Het
Rbak	G	A	5: 143,173,990	S436F	probably damaging	Het
Rpl11	A	G	4: 136,052,732		probably benign	Het
Ryr1	G	T	7: 29,086,185	Q1701K	probably damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Smg1	T	A	7: 118,157,163		probably benign	Het
St8sia2	T	C	7: 73,966,900	D109G	probably benign	Het
Stk-ps1	T	A	17: 36,398,213		noncoding transcript	Het
Stxbp3-ps	C	T	19: 9,557,970		noncoding transcript	Het
Taf1d	T	A	9: 15,308,850	F132I	probably damaging	Het
Tfap2b	A	G	1: 19,214,026	S35G	possibly damaging	Het
Tnk2	C	T	16: 32,669,523	T198I	probably benign	Het
Ube2q2	T	A	9: 55,191,879	V168E	possibly damaging	Het
Ucma	A	G	2: 4,981,330	R105G	probably benign	Het
Vmn2r97	C	T	17: 18,928,355	Q171*	probably null	Het
Wapl	T	C	14: 34,730,662		probably null	Het
Zfand4	T	A	6: 116,314,295	C397S	possibly damaging	Het
Zfhx3	A	G	8: 108,948,951	N2211S	probably damaging	Het
Zfp143	G	T	7: 110,070,480	G39C	probably benign	Het
Zfp568	T	A	7: 30,022,876	D414E	possibly damaging	Het
Zfp574	C	T	7: 25,081,950	A799V	probably damaging	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	112952843	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	112947376	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5125:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	112964468	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7555:Dhx29	UTSW	13	112927642	start gained	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	112952884	missense	possibly damaging	0.54
R9281:Dhx29	UTSW	13	112941706	missense	possibly damaging	0.82
R9450:Dhx29	UTSW	13	112947328	missense	possibly damaging	0.78
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTCAAGTTAGAGCCTGTG -3'
(R):5'- AACAGCGTTGGCCATTTGG -3'

Sequencing Primer
(F):5'- CAGTCAAGTTAGAGCCTGTGTTTTC -3'
(R):5'- ACCAGTCTCAAGTCTAAATGGTTAG -3'

Posted On

2017-08-28