Incidental Mutation 'R5587:Bcl3'
ID486874
Institutional Source Beutler Lab
Gene Symbol Bcl3
Ensembl Gene ENSMUSG00000053175
Gene NameB cell leukemia/lymphoma 3
SynonymsBcl-3
MMRRC Submission 043141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5587 (G1)
Quality Score64
Status Validated
Chromosome7
Chromosomal Location19808462-19822770 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19809634 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 10 (Y10*)
Ref Sequence ENSEMBL: ENSMUSP00000117754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120537] [ENSMUST00000135609]
Predicted Effect probably null
Transcript: ENSMUST00000120537
AA Change: Y302*
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: Y302*

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128181
Predicted Effect probably null
Transcript: ENSMUST00000135609
AA Change: Y10*
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175
AA Change: Y10*

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139680
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152768
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 96% (78/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,409 R120G probably benign Het
4930548H24Rik G T 5: 31,486,084 G53W probably benign Het
Acad11 A G 9: 104,063,767 T3A probably benign Het
Adamts18 G A 8: 113,775,360 Q290* probably null Het
Ahnak A G 19: 9,009,476 D2708G possibly damaging Het
Asxl3 T A 18: 22,525,247 C2105S probably benign Het
Atp8b1 A T 18: 64,539,210 F1028I probably damaging Het
Axdnd1 C G 1: 156,351,412 W615C probably damaging Het
Bmp2 T A 2: 133,554,646 V74E possibly damaging Het
Ccdc109b A C 3: 129,916,970 V271G probably benign Het
Ccdc78 C A 17: 25,786,677 P21Q probably benign Het
Cluap1 T A 16: 3,915,484 V199E probably damaging Het
Cntnap3 T C 13: 64,746,738 E1120G probably damaging Het
Col1a2 T A 6: 4,540,531 W1330R unknown Het
Coq4 A G 2: 29,795,514 probably null Het
Cwf19l1 G A 19: 44,120,877 T346I possibly damaging Het
Cyct T C 2: 76,354,203 Y68C probably damaging Het
Dnah10 T C 5: 124,793,913 L2368P probably benign Het
Dnah2 A T 11: 69,437,242 F3346I probably damaging Het
Dpp3 A T 19: 4,918,267 V259E probably damaging Het
Dpyd A C 3: 119,064,951 S605R probably damaging Het
Emc1 A G 4: 139,362,148 E209G probably damaging Het
Esrra A G 19: 6,920,207 S61P probably benign Het
Fam71d C A 12: 78,715,075 P171H probably damaging Het
Gbx2 T A 1: 89,933,122 probably benign Het
Hepacam A G 9: 37,384,684 H377R probably damaging Het
Igkv12-46 T C 6: 69,764,550 Y107C probably damaging Het
Intu A G 3: 40,675,308 D356G probably damaging Het
Izumo4 A T 10: 80,703,220 N113Y probably damaging Het
Krt86 G A 15: 101,473,593 A15T probably benign Het
Lhx8 A T 3: 154,311,679 S275R probably damaging Het
Lingo3 A T 10: 80,835,530 S189T probably damaging Het
Llgl1 T A 11: 60,710,342 M702K probably benign Het
Lpin1 T C 12: 16,573,714 Y223C probably damaging Het
Lrit3 G T 3: 129,788,898 A359E probably benign Het
Lrp2 T C 2: 69,499,263 E1720G probably benign Het
Nktr C T 9: 121,748,489 probably benign Het
Olfr1342 T A 4: 118,689,870 D194V probably damaging Het
Olfr1502 G A 19: 13,862,576 R261H probably damaging Het
Olfr347 A T 2: 36,734,621 Q100L probably damaging Het
Olfr617 T A 7: 103,584,531 Y170N probably benign Het
Olfr979 A T 9: 40,000,621 I202N possibly damaging Het
Olfr984 A T 9: 40,101,244 L82Q probably damaging Het
Pcdha4 T C 18: 36,954,822 V686A probably benign Het
Pelo A G 13: 115,089,873 V16A possibly damaging Het
Plcd1 A G 9: 119,073,832 S539P probably benign Het
Prss1 A G 6: 41,463,265 I179V possibly damaging Het
Ptgs2 T C 1: 150,105,555 Y530H probably damaging Het
Rai1 T C 11: 60,189,859 V1583A probably damaging Het
Raph1 T G 1: 60,498,473 D508A probably damaging Het
Rmnd5a A G 6: 71,394,619 probably benign Het
Rsf1 T C 7: 97,662,121 L686P probably benign Het
Samd9l T C 6: 3,373,291 I1323M possibly damaging Het
Scn1a T C 2: 66,273,081 N1934S probably benign Het
Sec23ip C T 7: 128,750,427 H176Y probably benign Het
Sh3glb2 A G 2: 30,354,851 probably null Het
Sis A G 3: 72,914,576 I1384T possibly damaging Het
Spata31d1a A C 13: 59,702,618 C565W probably damaging Het
Srbd1 T A 17: 86,127,801 Q278L probably damaging Het
Sry T C Y: 2,662,625 H345R unknown Het
Suox A T 10: 128,671,825 D111E probably damaging Het
Taar7a A T 10: 23,992,828 F218L probably benign Het
Tfcp2l1 C A 1: 118,664,762 N288K possibly damaging Het
Tmem128 G T 5: 38,260,421 R7L possibly damaging Het
Tmem266 A G 9: 55,437,566 N494S probably damaging Het
Tmprss3 T A 17: 31,193,992 H80L probably benign Het
Tnrc6c C T 11: 117,749,271 Q1211* probably null Het
Tns1 T A 1: 73,920,596 D1671V possibly damaging Het
Trmt1l T A 1: 151,435,704 probably benign Het
Tshz2 A T 2: 169,884,342 D286V probably damaging Het
Ttyh2 A G 11: 114,675,659 E39G probably benign Het
Vmn2r125 G A 4: 156,350,138 C73Y probably damaging Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Vmn2r61 T C 7: 42,300,487 F777S probably damaging Het
Vmn2r9 T C 5: 108,847,561 E407G probably damaging Het
Vwa3a A G 7: 120,780,235 N521S probably damaging Het
Zan C G 5: 137,391,762 S4816T unknown Het
Zc3h7b T C 15: 81,771,858 Y136H possibly damaging Het
Zfp101 T C 17: 33,381,321 K487R possibly damaging Het
Other mutations in Bcl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
memorial UTSW 7 19812484 missense probably damaging 1.00
sunrise UTSW 7 19811580 nonsense probably null
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
R7439:Bcl3 UTSW 7 19822611 missense probably benign
R7565:Bcl3 UTSW 7 19812494 missense probably damaging 1.00
RF022:Bcl3 UTSW 7 19809041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTTACCTTGCCGGCCTAAG -3'
(R):5'- TTTGACACAGCCCCATGTC -3'

Sequencing Primer
(F):5'- TTGCCGGCCTAAGCTCACTG -3'
(R):5'- CCATGTCCAGAATCATTTCAGG -3'
Posted On2017-09-06