Mutagenetix > Incidental Mutation

Incidental Mutation 'R5587:Cntnap3'

486875

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

043141-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R5587 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64746738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1120 (E1120G)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: E1120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: E1120G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.3260

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

96% (78/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,065,409	R120G	probably benign	Het
4930548H24Rik	G	T	5: 31,486,084	G53W	probably benign	Het
Acad11	A	G	9: 104,063,767	T3A	probably benign	Het
Adamts18	G	A	8: 113,775,360	Q290*	probably null	Het
Ahnak	A	G	19: 9,009,476	D2708G	possibly damaging	Het
Asxl3	T	A	18: 22,525,247	C2105S	probably benign	Het
Atp8b1	A	T	18: 64,539,210	F1028I	probably damaging	Het
Axdnd1	C	G	1: 156,351,412	W615C	probably damaging	Het
Bcl3	A	T	7: 19,809,634	Y10*	probably null	Het
Bmp2	T	A	2: 133,554,646	V74E	possibly damaging	Het
Ccdc78	C	A	17: 25,786,677	P21Q	probably benign	Het
Cluap1	T	A	16: 3,915,484	V199E	probably damaging	Het
Col1a2	T	A	6: 4,540,531	W1330R	unknown	Het
Coq4	A	G	2: 29,795,514		probably null	Het
Cwf19l1	G	A	19: 44,120,877	T346I	possibly damaging	Het
Cyct	T	C	2: 76,354,203	Y68C	probably damaging	Het
Dnah10	T	C	5: 124,793,913	L2368P	probably benign	Het
Dnah2	A	T	11: 69,437,242	F3346I	probably damaging	Het
Dpp3	A	T	19: 4,918,267	V259E	probably damaging	Het
Dpyd	A	C	3: 119,064,951	S605R	probably damaging	Het
Emc1	A	G	4: 139,362,148	E209G	probably damaging	Het
Esrra	A	G	19: 6,920,207	S61P	probably benign	Het
Fam71d	C	A	12: 78,715,075	P171H	probably damaging	Het
Gbx2	T	A	1: 89,933,122		probably benign	Het
Hepacam	A	G	9: 37,384,684	H377R	probably damaging	Het
Igkv12-46	T	C	6: 69,764,550	Y107C	probably damaging	Het
Intu	A	G	3: 40,675,308	D356G	probably damaging	Het
Izumo4	A	T	10: 80,703,220	N113Y	probably damaging	Het
Krt86	G	A	15: 101,473,593	A15T	probably benign	Het
Lhx8	A	T	3: 154,311,679	S275R	probably damaging	Het
Lingo3	A	T	10: 80,835,530	S189T	probably damaging	Het
Llgl1	T	A	11: 60,710,342	M702K	probably benign	Het
Lpin1	T	C	12: 16,573,714	Y223C		Het
Lrit3	G	T	3: 129,788,898	A359E	probably benign	Het
Lrp2	T	C	2: 69,499,263	E1720G	probably benign	Het
Mcub	A	C	3: 129,916,970	V271G	probably benign	Het
Nktr	C	T	9: 121,748,489		probably benign	Het
Olfr1342	T	A	4: 118,689,870	D194V	probably damaging	Het
Olfr1502	G	A	19: 13,862,576	R261H	probably damaging	Het
Olfr347	A	T	2: 36,734,621	Q100L	probably damaging	Het
Olfr617	T	A	7: 103,584,531	Y170N	probably benign	Het
Olfr979	A	T	9: 40,000,621	I202N	possibly damaging	Het
Olfr984	A	T	9: 40,101,244	L82Q	probably damaging	Het
Pcdha4	T	C	18: 36,954,822	V686A	probably benign	Het
Pelo	A	G	13: 115,089,873	V16A	possibly damaging	Het
Plcd1	A	G	9: 119,073,832	S539P	probably benign	Het
Prss1	A	G	6: 41,463,265	I179V	possibly damaging	Het
Ptgs2	T	C	1: 150,105,555	Y530H	probably damaging	Het
Rai1	T	C	11: 60,189,859	V1583A	probably damaging	Het
Raph1	T	G	1: 60,498,473	D508A	probably damaging	Het
Rmnd5a	A	G	6: 71,394,619		probably benign	Het
Rsf1	T	C	7: 97,662,121	L686P	probably benign	Het
Samd9l	T	C	6: 3,373,291	I1323M	possibly damaging	Het
Scn1a	T	C	2: 66,273,081	N1934S	probably benign	Het
Sec23ip	C	T	7: 128,750,427	H176Y	probably benign	Het
Sh3glb2	A	G	2: 30,354,851		probably null	Het
Sis	A	G	3: 72,914,576	I1384T	possibly damaging	Het
Spata31d1a	A	C	13: 59,702,618	C565W	probably damaging	Het
Srbd1	T	A	17: 86,127,801	Q278L	probably damaging	Het
Sry	T	C	Y: 2,662,625	H345R	unknown	Het
Suox	A	T	10: 128,671,825	D111E	probably damaging	Het
Taar7a	A	T	10: 23,992,828	F218L	probably benign	Het
Tfcp2l1	C	A	1: 118,664,762	N288K	possibly damaging	Het
Tmem128	G	T	5: 38,260,421	R7L	possibly damaging	Het
Tmem266	A	G	9: 55,437,566	N494S	probably damaging	Het
Tmprss3	T	A	17: 31,193,992	H80L	probably benign	Het
Tnrc6c	C	T	11: 117,749,271	Q1211*	probably null	Het
Tns1	T	A	1: 73,920,596	D1671V	possibly damaging	Het
Trmt1l	T	A	1: 151,435,704		probably benign	Het
Tshz2	A	T	2: 169,884,342	D286V	probably damaging	Het
Ttyh2	A	G	11: 114,675,659	E39G	probably benign	Het
Vmn2r125	G	A	4: 156,350,138	C73Y	probably damaging	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Vmn2r61	T	C	7: 42,300,487	F777S	probably damaging	Het
Vmn2r9	T	C	5: 108,847,561	E407G	probably damaging	Het
Vwa3a	A	G	7: 120,780,235	N521S	probably damaging	Het
Zan	C	G	5: 137,391,762	S4816T	unknown	Het
Zc3h7b	T	C	15: 81,771,858	Y136H	possibly damaging	Het
Zfp101	T	C	17: 33,381,321	K487R	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGTTTGAAAGAGAGACTGGC -3'
(R):5'- TTGGCCACAGAAAGCACTG -3'

Sequencing Primer
(F):5'- TTTGAAAGAGAGACTGGCAAACAAAG -3'
(R):5'- CAGGAACAGTAACTTTTGTGTGC -3'

Posted On

2017-09-06