Incidental Mutation 'PIT4142001:Sp110'
ID486884
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #PIT4142001 (G1)
Quality Score135.008
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85586250 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 262 (R262Q)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: R262Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: R262Q

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers
Posted On2017-09-21