Incidental Mutation 'PIT4142001:Hjurp'
ID 486891
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # PIT4142001 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG to T at 88194000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T G 17: 84,981,022 (GRCm39) Y107S possibly damaging Het
Abhd8 T C 8: 71,914,499 (GRCm39) E43G probably damaging Het
Ap1b1 T G 11: 4,990,360 (GRCm39) L872W probably damaging Het
Arid1b T A 17: 5,389,518 (GRCm39) M1688K probably damaging Het
Brca1 T C 11: 101,413,248 (GRCm39) probably benign Het
C4b C T 17: 34,952,675 (GRCm39) V1151I probably benign Het
Card6 T A 15: 5,128,113 (GRCm39) Q1094H unknown Het
Cd22 C A 7: 30,577,224 (GRCm39) V28F possibly damaging Het
Cdc42bpa A T 1: 179,859,125 (GRCm39) N109I probably damaging Het
Ces2b T C 8: 105,563,442 (GRCm39) Y390H probably damaging Het
Clca4a T C 3: 144,674,072 (GRCm39) Y221C probably damaging Het
Cntnap5a G T 1: 115,612,686 (GRCm39) probably benign Het
Cyp4a10 C A 4: 115,382,072 (GRCm39) H251Q probably damaging Het
Dcc A T 18: 71,517,297 (GRCm39) probably null Het
Dnaaf5 A G 5: 139,171,273 (GRCm39) K812E possibly damaging Het
Dnajc13 T C 9: 104,115,672 (GRCm39) T46A probably damaging Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 G C 10: 58,059,278 (GRCm39) P492R probably damaging Het
Duxf3 C A 10: 58,066,990 (GRCm39) C503F probably damaging Het
Duxf3 C A 10: 58,066,810 (GRCm39) R563M probably damaging Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eps8l1 G A 7: 4,474,414 (GRCm39) S295N probably benign Het
Etfdh C T 3: 79,517,174 (GRCm39) S345N probably damaging Het
Fat3 A G 9: 15,903,414 (GRCm39) probably null Het
G530012D18Rik T G 1: 85,504,925 (GRCm39) probably benign Het
Gabra4 T C 5: 71,729,106 (GRCm39) N558S probably damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 T C 9: 3,001,350 (GRCm39) L142S probably benign Het
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Het
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,497,361 (GRCm39) probably null Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Het
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21663 C T 5: 26,143,767 (GRCm39) R185H probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Gpr107 T A 2: 31,057,083 (GRCm39) D58E probably benign Het
Gstm7 AAC A 3: 107,838,799 (GRCm39) probably null Het
Hc C T 2: 34,921,833 (GRCm39) probably benign Het
Hnrnpa2b1 A T 6: 51,441,089 (GRCm39) M327K probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Ifi206 A G 1: 173,308,730 (GRCm39) V422A probably benign Het
Igf2bp3 A G 6: 49,094,317 (GRCm39) V151A probably damaging Het
Ivl TTGC T 3: 92,479,608 (GRCm39) probably benign Het
Kndc1 TC T 7: 139,503,692 (GRCm39) probably null Het
Lig1 GC G 7: 13,039,850 (GRCm39) probably null Het
Lrit1 A G 14: 36,783,998 (GRCm39) Y442C probably damaging Het
Map3k21 C A 8: 126,664,047 (GRCm39) P536H probably damaging Het
Marchf10 T A 11: 105,281,346 (GRCm39) Y313F probably benign Het
Mcm5 A G 8: 75,853,864 (GRCm39) H706R probably benign Het
Mlycd T G 8: 120,137,199 (GRCm39) I473S probably damaging Het
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Het
Myo5c T C 9: 75,191,230 (GRCm39) V1088A probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Het
Ndufs1 A G 1: 63,198,907 (GRCm39) probably benign Het
Or4n4 A G 14: 50,518,784 (GRCm39) *309Q probably null Het
Pak2 A T 16: 31,841,930 (GRCm39) Y443N probably damaging Het
Pik3r6 T C 11: 68,417,931 (GRCm39) I73T probably damaging Het
Pla2g4c A G 7: 13,077,316 (GRCm39) E286G probably benign Het
Plekhn1 G A 4: 156,309,397 (GRCm39) R196* probably null Het
Pramel41 A C 5: 94,594,643 (GRCm39) K168Q probably benign Het
Prdm10 T A 9: 31,237,063 (GRCm39) D145E probably benign Het
Ptgis T C 2: 167,048,750 (GRCm39) Y422C probably damaging Het
Ralgapb A G 2: 158,272,342 (GRCm39) E132G probably benign Het
Rasgrf1 G A 9: 89,797,626 (GRCm39) R168H possibly damaging Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rpl5 T C 5: 108,055,049 (GRCm39) probably benign Het
Ryr2 T C 13: 11,722,682 (GRCm39) K2603E probably damaging Het
Sap130 T C 18: 31,800,064 (GRCm39) probably null Het
Scn5a C A 9: 119,315,324 (GRCm39) D1794Y probably damaging Het
Sec31a A T 5: 100,555,134 (GRCm39) S29T probably damaging Het
Selplg T G 5: 113,957,689 (GRCm39) K206Q probably benign Het
Sfmbt1 A T 14: 30,538,714 (GRCm39) probably null Het
Sirpb1a A T 3: 15,476,258 (GRCm39) F180I probably benign Het
Slc44a4 A G 17: 35,140,251 (GRCm39) I67V probably damaging Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Stab2 A T 10: 86,703,039 (GRCm39) S1848R possibly damaging Het
Stat6 T C 10: 127,494,099 (GRCm39) V642A possibly damaging Het
Tfam T C 10: 71,070,813 (GRCm39) K63R possibly damaging Het
Trim2 T C 3: 84,098,164 (GRCm39) N379S probably benign Het
Trp63 C T 16: 25,684,013 (GRCm39) T300I probably damaging Het
Tymp C A 15: 89,260,548 (GRCm39) W90L probably damaging Het
Ubr5 A G 15: 38,042,153 (GRCm39) S148P Het
Ugt1a10 TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Usp47 T C 7: 111,703,548 (GRCm39) probably benign Het
Uvssa C T 5: 33,549,428 (GRCm39) A363V probably benign Het
Vldlr T A 19: 27,212,269 (GRCm39) D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn1r67 T A 7: 10,180,877 (GRCm39) M47K probably benign Het
Vmn1r87 A T 7: 12,866,112 (GRCm39) H58Q probably benign Het
Vmn1r89 A G 7: 12,953,515 (GRCm39) T84A probably benign Het
Vmn2r109 T C 17: 20,774,839 (GRCm39) probably null Het
Xirp2 T C 2: 67,349,706 (GRCm39) probably benign Het
Zbtb2 A G 10: 4,319,493 (GRCm39) S178P probably benign Het
Zfp534 C A 4: 147,762,770 (GRCm39) D21Y probably benign Het
Zfp534 C T 4: 147,760,031 (GRCm39) E213K probably benign Het
Zfp804b C T 5: 6,819,422 (GRCm39) V1214I probably damaging Het
Zfp82 G T 7: 29,756,701 (GRCm39) T63K probably damaging Het
Zfp986 C T 4: 145,625,513 (GRCm39) R58C probably benign Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers
Posted On 2017-09-21