Incidental Mutation 'PIT4142001:Cntnap5a'
ID486894
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4142001 (G1)
Quality Score83.0076
Status Not validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 115684956 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect probably benign
Transcript: ENSMUST00000043725
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189918
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense probably damaging 1.00
R7290:Cntnap5a UTSW 1 116221889 missense probably damaging 1.00
R7342:Cntnap5a UTSW 1 116060122 missense probably benign 0.00
R7367:Cntnap5a UTSW 1 116442295 missense probably benign 0.00
R7373:Cntnap5a UTSW 1 116580637 missense probably benign 0.20
R7426:Cntnap5a UTSW 1 116442380 missense probably benign 0.03
R7444:Cntnap5a UTSW 1 116292349 missense probably benign
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers
Posted On2017-09-21