Incidental Mutation 'PIT4142001:Cdc42bpa'
ID486895
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #PIT4142001 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180031560 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 109 (N109I)
Ref Sequence ENSEMBL: ENSMUSP00000075980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]
Predicted Effect probably damaging
Transcript: ENSMUST00000076687
AA Change: N109I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: N109I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097450
AA Change: N109I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: N109I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097453
AA Change: N109I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: N109I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111117
AA Change: N109I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: N109I

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132894
Predicted Effect probably benign
Transcript: ENSMUST00000134959
SMART Domains Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
PDB:4AW2|A 2 90 1e-58 PDB
SCOP:d1koba_ 50 90 7e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143350
Predicted Effect probably damaging
Transcript: ENSMUST00000212756
AA Change: N109I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.5710 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trim2 T C 3: 84,190,857 N379S probably benign Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTGTAGAAAACTTGGGAAG -3'
(R):5'- GAGTCCACCTTGCTACATATTCAG -3'

Sequencing Primer
(F):5'- ATTTAGGATCTTAGAATTGAGCAGC -3'
(R):5'- CACCTTGCTACATATTCAGACTATAC -3'
Posted On2017-09-21