Incidental Mutation 'PIT4142001:Trim2'
ID486903
Institutional Source Beutler Lab
Gene Symbol Trim2
Ensembl Gene ENSMUSG00000027993
Gene Nametripartite motif-containing 2
Synonymsneural activity-related ring finger protein, narf
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #PIT4142001 (G1)
Quality Score201.009
Status Validated
Chromosome3
Chromosomal Location84160439-84306877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84190857 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 379 (N379S)
Ref Sequence ENSEMBL: ENSMUSP00000103323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054990] [ENSMUST00000065380] [ENSMUST00000107691] [ENSMUST00000107692] [ENSMUST00000107693] [ENSMUST00000107695] [ENSMUST00000122849] [ENSMUST00000132283] [ENSMUST00000147901]
Predicted Effect probably benign
Transcript: ENSMUST00000054990
AA Change: N388S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049902
Gene: ENSMUSG00000027993
AA Change: N388S

DomainStartEndE-ValueType
RING 49 89 3.5e-9 SMART
BBOX 139 180 3.52e-14 SMART
BBC 187 313 1.7e-38 SMART
IG_FLMN 350 450 2.41e-30 SMART
Pfam:NHL 512 539 2e-8 PFAM
Pfam:NHL 559 586 1.1e-8 PFAM
Pfam:NHL 601 628 2.1e-7 PFAM
Pfam:NHL 648 675 5.8e-10 PFAM
Pfam:NHL 695 722 3.5e-12 PFAM
Pfam:NHL 739 766 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065380
AA Change: N362S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069922
Gene: ENSMUSG00000027993
AA Change: N362S

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107691
AA Change: N362S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103319
Gene: ENSMUSG00000027993
AA Change: N362S

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107692
AA Change: N362S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103320
Gene: ENSMUSG00000027993
AA Change: N362S

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107693
AA Change: N362S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103321
Gene: ENSMUSG00000027993
AA Change: N362S

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
BBC 161 287 1.7e-38 SMART
IG_FLMN 324 424 2.41e-30 SMART
Pfam:NHL 486 513 8e-8 PFAM
Pfam:NHL 533 560 6.6e-8 PFAM
Pfam:NHL 575 602 1.1e-6 PFAM
Pfam:NHL 622 649 5.6e-9 PFAM
Pfam:NHL 669 696 4.1e-12 PFAM
Pfam:NHL 713 740 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107695
AA Change: N379S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103323
Gene: ENSMUSG00000027993
AA Change: N379S

DomainStartEndE-ValueType
RING 40 80 3.5e-9 SMART
BBOX 130 171 3.52e-14 SMART
BBC 178 304 1.7e-38 SMART
IG_FLMN 341 441 2.41e-30 SMART
Pfam:NHL 503 530 9.1e-8 PFAM
Pfam:NHL 550 577 7.5e-8 PFAM
Pfam:NHL 592 619 1.2e-6 PFAM
Pfam:NHL 639 666 6.3e-9 PFAM
Pfam:NHL 686 713 4.7e-12 PFAM
Pfam:NHL 730 757 5.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122849
SMART Domains Protein: ENSMUSP00000120981
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 41 81 3.5e-9 SMART
BBOX 131 172 3.52e-14 SMART
Blast:BBC 179 213 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128574
Predicted Effect probably benign
Transcript: ENSMUST00000132283
SMART Domains Protein: ENSMUSP00000118888
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
BBOX 113 154 3.52e-14 SMART
Blast:BBC 161 191 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140568
Predicted Effect probably benign
Transcript: ENSMUST00000147901
SMART Domains Protein: ENSMUSP00000121055
Gene: ENSMUSG00000027993

DomainStartEndE-ValueType
RING 23 63 3.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156347
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (105/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. It plays a neuroprotective role and functions as an E3-ubiquitin ligase in proteasome-mediated degradation of target proteins. Mutations in this gene can cause early-onset axonal neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit tremors, ataxia and seizures associated with neurodegeneration of Purkinje cells, deep cerebellar nuclei and retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Abcg5 T G 17: 84,673,594 Y107S possibly damaging Het
Abhd8 T C 8: 71,461,855 E43G probably damaging Het
Ap1b1 T G 11: 5,040,360 L872W probably damaging Het
Arid1b T A 17: 5,339,243 M1688K probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G C 10: 58,223,456 P492R probably damaging Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Brca1 T C 11: 101,522,422 probably benign Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
C4b C T 17: 34,733,701 V1151I probably benign Het
Card6 T A 15: 5,098,631 Q1094H unknown Het
Cd22 C A 7: 30,877,799 V28F possibly damaging Het
Cdc42bpa A T 1: 180,031,560 N109I probably damaging Het
Ces2b T C 8: 104,836,810 Y390H probably damaging Het
Clca4a T C 3: 144,968,311 Y221C probably damaging Het
Cntnap5a G T 1: 115,684,956 probably benign Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dcc A T 18: 71,384,226 probably null Het
Dnaaf5 A G 5: 139,185,518 K812E possibly damaging Het
Dnajc13 T C 9: 104,238,473 T46A probably damaging Het
Duxf3 C A 10: 58,231,168 C503F probably damaging Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Duxf3 C A 10: 58,230,988 R563M probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Etfdh C T 3: 79,609,867 S345N probably damaging Het
Fat3 A G 9: 15,992,118 probably null Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gabra4 T C 5: 71,571,763 N558S probably damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 T C 9: 3,001,350 L142S probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Het
Gm10800 C A 2: 98,666,905 V123F probably benign Het
Gm10800 CAAGAAAACTGAAAATCA C 2: 98,667,016 probably null Het
Gm10801 A G 2: 98,662,303 R23G probably benign Het
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21663 C T 5: 25,938,769 R185H probably benign Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Gm7682 A C 5: 94,446,784 K168Q probably benign Het
Gpr107 T A 2: 31,167,071 D58E probably benign Het
Gstm7 AAC A 3: 107,931,483 probably null Het
Hc C T 2: 35,031,821 probably benign Het
Hjurp A C 1: 88,266,046 V380G probably damaging Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hjurp A G 1: 88,266,561 probably benign Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hnrnpa2b1 A T 6: 51,464,109 M327K probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Ifi206 A G 1: 173,481,164 V422A probably benign Het
Igf2bp3 A G 6: 49,117,383 V151A probably damaging Het
Ivl TTGC T 3: 92,572,301 probably benign Het
Kndc1 TC T 7: 139,923,776 probably null Het
Lig1 GC G 7: 13,305,924 probably null Het
Lrit1 A G 14: 37,062,041 Y442C probably damaging Het
Map3k21 C A 8: 125,937,308 P536H probably damaging Het
March10 T A 11: 105,390,520 Y313F probably benign Het
Mcm5 A G 8: 75,127,236 H706R probably benign Het
Mlycd T G 8: 119,410,460 I473S probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc4 C G 16: 32,755,676 probably benign Het
Muc4 T A 16: 32,755,684 probably benign Het
Myo5c T C 9: 75,283,948 V1088A probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Het
Ndufs1 A G 1: 63,159,748 probably benign Het
Olfr732 A G 14: 50,281,327 *309Q probably null Het
Pak2 A T 16: 32,023,112 Y443N probably damaging Het
Pik3r6 T C 11: 68,527,105 I73T probably damaging Het
Pla2g4c A G 7: 13,343,391 E286G probably benign Het
Plekhn1 G A 4: 156,224,940 R196* probably null Het
Prdm10 T A 9: 31,325,767 D145E probably benign Het
Ptgis T C 2: 167,206,830 Y422C probably damaging Het
Ralgapb A G 2: 158,430,422 E132G probably benign Het
Rasgrf1 G A 9: 89,915,573 R168H possibly damaging Het
Rpl5 T C 5: 107,907,183 probably benign Het
Ryr2 T C 13: 11,707,796 K2603E probably damaging Het
Sap130 T C 18: 31,667,011 probably null Het
Scn5a C A 9: 119,486,258 D1794Y probably damaging Het
Sec31a A T 5: 100,407,275 S29T probably damaging Het
Selplg T G 5: 113,819,628 K206Q probably benign Het
Sfmbt1 A T 14: 30,816,757 probably null Het
Sirpb1a A T 3: 15,411,198 F180I probably benign Het
Slc44a4 A G 17: 34,921,275 I67V probably damaging Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Stab2 A T 10: 86,867,175 S1848R possibly damaging Het
Stat6 T C 10: 127,658,230 V642A possibly damaging Het
Tfam T C 10: 71,234,983 K63R possibly damaging Het
Trp63 C T 16: 25,865,263 T300I probably damaging Het
Tymp C A 15: 89,376,345 W90L probably damaging Het
Ubr5 A G 15: 38,041,909 S148P probably damaging Het
Ugt1a10 TTCA T 1: 88,216,158 probably benign Het
Usp47 T C 7: 112,104,341 probably benign Het
Uvssa C T 5: 33,392,084 A363V probably benign Het
Vldlr T A 19: 27,234,869 D94E probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn1r67 T A 7: 10,446,950 M47K probably benign Het
Vmn1r87 A T 7: 13,132,185 H58Q probably benign Het
Vmn1r89 A G 7: 13,219,588 T84A probably benign Het
Vmn2r109 T C 17: 20,554,577 probably null Het
Xirp2 T C 2: 67,519,362 probably benign Het
Zbtb2 A G 10: 4,369,493 S178P probably benign Het
Zfp534 C T 4: 147,675,574 E213K probably benign Het
Zfp534 C A 4: 147,678,313 D21Y probably benign Het
Zfp804b C T 5: 6,769,422 V1214I probably damaging Het
Zfp82 G T 7: 30,057,276 T63K probably damaging Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Trim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trim2 APN 3 84208289 missense probably damaging 1.00
IGL01658:Trim2 APN 3 84210285 missense probably benign 0.33
IGL02943:Trim2 APN 3 84178176 missense probably benign 0.45
R0149:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R0158:Trim2 UTSW 3 84210169 splice site probably benign
R0361:Trim2 UTSW 3 84190776 missense probably damaging 1.00
R1270:Trim2 UTSW 3 84167677 missense probably damaging 1.00
R1651:Trim2 UTSW 3 84167650 critical splice donor site probably null
R1756:Trim2 UTSW 3 84190800 missense possibly damaging 0.52
R1938:Trim2 UTSW 3 84177792 missense possibly damaging 0.94
R2046:Trim2 UTSW 3 84208289 missense probably damaging 1.00
R2192:Trim2 UTSW 3 84190918 nonsense probably null
R3696:Trim2 UTSW 3 84190851 missense probably benign 0.05
R4981:Trim2 UTSW 3 84177735 missense probably damaging 1.00
R5389:Trim2 UTSW 3 84167653 missense probably null 0.60
R5735:Trim2 UTSW 3 84167722 missense probably damaging 1.00
R7228:Trim2 UTSW 3 84192181 missense probably benign 0.01
R7297:Trim2 UTSW 3 84210233 missense probably damaging 1.00
R7640:Trim2 UTSW 3 84190906 missense probably benign 0.07
R7853:Trim2 UTSW 3 84305230 splice site probably benign
R7993:Trim2 UTSW 3 84190719 missense probably damaging 1.00
R8205:Trim2 UTSW 3 84193339 missense probably damaging 1.00
R8516:Trim2 UTSW 3 84208320 missense probably damaging 1.00
X0065:Trim2 UTSW 3 84165173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTGACTCGTCGCTTCACG -3'
(R):5'- TTTTATCGTGGAAACGGAGGGAC -3'

Sequencing Primer
(F):5'- GCGGATGACCTTGAGCTTAAAC -3'
(R):5'- CTGAAGAAGTCTATCCACAACCTGGG -3'
Posted On2017-09-21